General Introduction
********************
This file documents the networking features in GNU Awk (‘gawk’) version
4.0 and later.
This is Edition 1.6 of ‘TCP/IP Internetworking with ‘gawk’’, for the
5.2.0 (or later) version of the GNU implementation of AWK.
Copyright (C) 2000, 2001, 2002, 2004, 2009, 2010, 2016, 2019, 2020,
2021, 2023 Free Software Foundation, Inc.
Permission is granted to copy, distribute and/or modify this document
under the terms of the GNU Free Documentation License, Version 1.3 or
any later version published by the Free Software Foundation; with the
Invariant Sections being “GNU General Public License”, the Front-Cover
texts being (a) (see below), and with the Back-Cover Texts being (b)
(see below). A copy of the license is included in the section entitled
“GNU Free Documentation License”.
a. “A GNU Manual”
b. “You have the freedom to copy and modify this GNU manual. Buying
copies from the FSF supports it in developing GNU and promoting
software freedom.”
General Introduction
Preface
1 Networking Concepts
1.1 Reliable Byte-streams (Phone Calls)
1.2 Best-effort Datagrams (Mailed Letters)
1.3 The Internet Protocols
1.3.1 The Basic Internet Protocols
1.3.2 TCP and UDP Ports
1.4 Making TCP/IP Connections (And Some Terminology)
2 Networking With ‘gawk’
2.1 ‘gawk’’s Networking Mechanisms
2.1.1 The Fields of the Special File Name
2.1.2 Comparing Protocols
2.1.2.1 ‘/inet/tcp’
2.1.2.2 ‘/inet/udp’
2.2 Establishing a TCP Connection
2.3 Troubleshooting Connection Problems
2.4 Interacting with a Network Service
2.5 Setting Up a Service
2.6 Reading Email
2.7 Reading a Web Page
2.8 A Primitive Web Service
2.9 A Web Service with Interaction
2.9.1 A Simple CGI Library
2.10 A Simple Web Server
2.11 Network Programming Caveats
2.12 Where To Go From Here
3 Some Applications and Techniques
3.1 PANIC: An Emergency Web Server
3.2 GETURL: Retrieving Web Pages
3.3 REMCONF: Remote Configuration of Embedded Systems
3.4 URLCHK: Look for Changed Web Pages
3.5 WEBGRAB: Extract Links from a Page
3.6 STATIST: Graphing a Statistical Distribution
3.7 MAZE: Walking Through a Maze In Virtual Reality
3.8 MOBAGWHO: a Simple Mobile Agent
3.9 STOXPRED: Stock Market Prediction As A Service
3.10 PROTBASE: Searching Through A Protein Database
4 Related Links
GNU Free Documentation License
ADDENDUM: How to use this License for your documents
Index
Preface
*******
In May of 1997, Jürgen Kahrs felt the need for network access from
‘awk’, and, with a little help from me, set about adding features to do
this for ‘gawk’. At that time, he wrote the bulk of this Info file.
The code and documentation were added to the ‘gawk’ 3.1 development
tree, and languished somewhat until I could finally get down to some
serious work on that version of ‘gawk’. This finally happened in the
middle of 2000.
Meantime, Jürgen wrote an article about the Internet special files
and ‘|&’ operator for ‘Linux Journal’, and made a networking patch for
the production versions of ‘gawk’ available from his home page. In
August of 2000 (for ‘gawk’ 3.0.6), this patch also made it to the main
GNU ‘ftp’ distribution site.
For release with ‘gawk’, I edited Jürgen’s prose for English grammar
and style, as he is not a native English speaker. I also rearranged the
material somewhat for what I felt was a better order of presentation,
and (re)wrote some of the introductory material.
The majority of this document and the code are his work, and the high
quality and interesting ideas speak for themselves. It is my hope that
these features will be of significant value to the ‘awk’ community.
Arnold Robbins
Nof Ayalon, ISRAEL
March, 2001
1 Networking Concepts
*********************
This major node provides a (necessarily) brief introduction to computer
networking concepts. For many applications of ‘gawk’ to TCP/IP
networking, we hope that this is enough. For more advanced tasks, you
will need deeper background, and it may be necessary to switch to
lower-level programming in C or C++.
There are two real-life models for the way computers send messages to
each other over a network. While the analogies are not perfect, they
are close enough to convey the major concepts. These two models are the
phone system (reliable byte-stream communications), and the postal
system (best-effort datagrams).
1.1 Reliable Byte-streams (Phone Calls)
=======================================
When you make a phone call, the following steps occur:
1. You dial a number.
2. The phone system connects to the called party, telling them there
is an incoming call. (Their phone rings.)
3. The other party answers the call, or, in the case of a computer
network, refuses to answer the call.
4. Assuming the other party answers, the connection between you is now
a “duplex” (two-way), “reliable” (no data lost), sequenced (data
comes out in the order sent) data stream.
5. You and your friend may now talk freely, with the phone system
moving the data (your voices) from one end to the other. From your
point of view, you have a direct end-to-end connection with the
person on the other end.
The same steps occur in a duplex reliable computer networking
connection. There is considerably more overhead in setting up the
communications, but once it’s done, data moves in both directions,
reliably, in sequence.
1.2 Best-effort Datagrams (Mailed Letters)
==========================================
Suppose you mail three different documents to your office on the other
side of the country on two different days. Doing so entails the
following.
1. Each document travels in its own envelope.
2. Each envelope contains both the sender and the recipient address.
3. Each envelope may travel a different route to its destination.
4. The envelopes may arrive in a different order from the one in which
they were sent.
5. One or more may get lost in the mail. (Although, fortunately, this
does not occur very often.)
6. In a computer network, one or more “packets” may also arrive
multiple times. (This doesn’t happen with the postal system!)
The important characteristics of datagram communications, like those
of the postal system are thus:
• Delivery is “best effort;” the data may never get there.
• Each message is self-contained, including the source and
destination addresses.
• Delivery is _not_ sequenced; packets may arrive out of order,
and/or multiple times.
• Unlike the phone system, overhead is considerably lower. It is not
necessary to set up the call first.
The price the user pays for the lower overhead of datagram
communications is exactly the lower reliability; it is often necessary
for user-level protocols that use datagram communications to add their
own reliability features on top of the basic communications.
1.3 The Internet Protocols
==========================
The Internet Protocol Suite (usually referred to as just TCP/IP)(1)
consists of a number of different protocols at different levels or
“layers.” For our purposes, three protocols provide the fundamental
communications mechanisms. All other defined protocols are referred to
as user-level protocols (e.g., HTTP, used later in this Info file).
---------- Footnotes ----------
(1) It should be noted that although the Internet seems to have
conquered the world, there are other networking protocol suites in
existence and in use.
1.3.1 The Basic Internet Protocols
----------------------------------
IP
The Internet Protocol. This protocol is almost never used directly
by applications. It provides the basic packet delivery and routing
infrastructure of the Internet. Much like the phone company’s
switching centers or the Post Office’s trucks, it is not of much
day-to-day interest to the regular user (or programmer). It
happens to be a best effort datagram protocol. In the early
twenty-first century, there are two versions of this protocol in
use:
IPv4
The original version of the Internet Protocol, with 32-bit
addresses, on which most of the current Internet is based.
IPv6
The “next generation” of the Internet Protocol, with 128-bit
addresses. This protocol is in wide use in certain parts of
the world, but has not yet replaced IPv4.(1)
Versions of the other protocols that sit “atop” IP exist for both
IPv4 and IPv6. However, as the IPv6 versions are fundamentally the
same as the original IPv4 versions, we will not distinguish further
between them.
UDP
The User Datagram Protocol. This is a best effort datagram
protocol. It provides a small amount of extra reliability over IP,
and adds the notion of “ports”, described in *note TCP and UDP
Ports: Ports.
TCP
The Transmission Control Protocol. This is a duplex, reliable,
sequenced byte-stream protocol, again layered on top of IP, and
also providing the notion of ports. This is the protocol that you
will most likely use when using ‘gawk’ for network programming.
All other user-level protocols use either TCP or UDP to do their
basic communications. Examples are SMTP (Simple Mail Transfer
Protocol), FTP (File Transfer Protocol), and HTTP (HyperText Transfer
Protocol).
---------- Footnotes ----------
(1) There isn’t an IPv5.
1.3.2 TCP and UDP Ports
-----------------------
In the postal system, the address on an envelope indicates a physical
location, such as a residence or office building. But there may be more
than one person at the location; thus you have to further quantify the
recipient by putting a person or company name on the envelope.
In the phone system, one phone number may represent an entire
company, in which case you need a person’s extension number in order to
reach that individual directly. Or, when you call a home, you have to
say, “May I please speak to ...” before talking to the person directly.
IP networking provides the concept of addressing. An IP address
represents a particular computer, but no more. In order to reach the
mail service on a system, or the FTP or WWW service on a system, you
must have some way to further specify which service you want. In the
Internet Protocol suite, this is done with “port numbers”, which
represent the services, much like an extension number used with a phone
number.
Port numbers are 16-bit integers. Unix and Unix-like systems reserve
ports below 1024 for “well known” services, such as SMTP, FTP, and HTTP.
Numbers 1024 and above may be used by any application, although there is
no promise made that a particular port number is always available.
1.4 Making TCP/IP Connections (And Some Terminology)
====================================================
Two terms come up repeatedly when discussing networking: “client” and
“server”. For now, we’ll discuss these terms at the “connection level”,
when first establishing connections between two processes on different
systems over a network. (Once the connection is established, the higher
level, or “application level” protocols, such as HTTP or FTP, determine
who is the client and who is the server. Often, it turns out that the
client and server are the same in both roles.)
The “server” is the system providing the service, such as the web
server or email server. It is the “host” (system) which is _connected
to_ in a transaction. For this to work though, the server must be
expecting connections. Much as there has to be someone at the office
building to answer the phone,(1) the server process (usually) has to be
started first and be waiting for a connection.
The “client” is the system requesting the service. It is the system
_initiating the connection_ in a transaction. (Just as when you pick up
the phone to call an office or store.)
In the TCP/IP framework, each end of a connection is represented by a
pair of (ADDRESS, PORT) pairs. For the duration of the connection, the
ports in use at each end are unique, and cannot be used simultaneously
by other processes on the same system. (Only after closing a connection
can a new one be built up on the same port. This is contrary to the
usual behavior of fully developed web servers which have to avoid
situations in which they are not reachable. We have to pay this price
in order to enjoy the benefits of a simple communication paradigm in
‘gawk’.)
Furthermore, once the connection is established, communications are
“synchronous”.(2) I.e., each end waits on the other to finish
transmitting, before replying. This is much like two people in a phone
conversation. While both could talk simultaneously, doing so usually
doesn’t work too well.
In the case of TCP, the synchronicity is enforced by the protocol
when sending data. Data writes “block” until the data have been
received on the other end. For both TCP and UDP, data reads block until
there is incoming data waiting to be read. This is summarized in the
following table, where an “x” indicates that the given action blocks.
TCP x x
UDP x
---------- Footnotes ----------
(1) In the days before voice mail systems!
(2) For the technically savvy, data reads block—if there’s no
incoming data, the program is made to wait until there is, instead of
receiving a “there’s no data” error return.
2 Networking With ‘gawk’
************************
The ‘awk’ programming language was originally developed as a
pattern-matching language for writing short programs to perform data
manipulation tasks. ‘awk’’s strength is the manipulation of textual
data that is stored in files. It was never meant to be used for
networking purposes. To exploit its features in a networking context,
it’s necessary to use an access mode for network connections that
resembles the access of files as closely as possible.
‘awk’ is also meant to be a prototyping language. It is used to
demonstrate feasibility and to play with features and user interfaces.
This can be done with file-like handling of network connections. ‘gawk’
trades the lack of many of the advanced features of the TCP/IP family of
protocols for the convenience of simple connection handling. The
advanced features are available when programming in C or Perl. In fact,
the network programming in this major node is very similar to what is
described in books such as ‘Internet Programming with Python’, ‘Advanced
Perl Programming’, or ‘Web Client Programming with Perl’.
However, you can do the programming here without first having to
learn object-oriented ideology; underlying languages such as Tcl/Tk,
Perl, Python; or all of the libraries necessary to extend these
languages before they are ready for the Internet.
This major node demonstrates how to use the TCP protocol. The UDP
protocol is much less important for most users.
2.1 ‘gawk’’s Networking Mechanisms
==================================
The ‘|&’ operator for use in communicating with a “coprocess” is
described in *note Two-way Communications With Another Process:
(gawk)Two-way I/O. It shows how to do two-way I/O to a separate process,
sending it data with ‘print’ or ‘printf’ and reading data with
‘getline’. If you haven’t read it already, you should detour there to
do so.
‘gawk’ transparently extends the two-way I/O mechanism to simple
networking through the use of special file names. When a “coprocess”
that matches the special files we are about to describe is started,
‘gawk’ creates the appropriate network connection, and then two-way I/O
proceeds as usual.
At the C, C++, and Perl level, networking is accomplished via
“sockets”, an Application Programming Interface (API) originally
developed at the University of California at Berkeley that is now used
almost universally for TCP/IP networking. Socket level programming,
while fairly straightforward, requires paying attention to a number of
details, as well as using binary data. It is not well-suited for use
from a high-level language like ‘awk’. The special files provided in
‘gawk’ hide the details from the programmer, making things much simpler
and easier to use.
The special file name for network access is made up of several
fields, all of which are mandatory:
/NET-TYPE/PROTOCOL/LOCALPORT/HOSTNAME/REMOTEPORT
The NET-TYPE field lets you specify IPv4 versus IPv6, or lets you
allow the system to choose.
2.1.1 The Fields of the Special File Name
-----------------------------------------
This node explains the meaning of all of the fields, as well as the
range of values and the defaults. All of the fields are mandatory. To
let the system pick a value, or if the field doesn’t apply to the
protocol, specify it as ‘0’ (zero):
NET-TYPE
This is one of ‘inet4’ for IPv4, ‘inet6’ for IPv6, or ‘inet’ to use
the system default (which is likely to be IPv4). For the rest of
this document, we will use the generic ‘/inet’ in our descriptions
of how ‘gawk’’s networking works.
PROTOCOL
Determines which member of the TCP/IP family of protocols is
selected to transport the data across the network. There are two
possible values (always written in lowercase): ‘tcp’ and ‘udp’.
The exact meaning of each is explained later in this node.
LOCALPORT
Determines which port on the local machine is used to communicate
across the network. Application-level clients usually use ‘0’ to
indicate they do not care which local port is used—instead they
specify a remote port to connect to.
It is vital for application-level servers to use a number different
from ‘0’ here because their service has to be available at a
specific publicly known port number. It is possible to use a name
from ‘/etc/services’ here.
HOSTNAME
Determines which remote host is to be at the other end of the
connection. Application-level clients must enter a name different
from ‘0’. The name can be either symbolic (e.g.,
‘jpl-devvax.jpl.nasa.gov’) or numeric (e.g., ‘128.149.1.143’).
Application-level servers must fill this field with a ‘0’ to
indicate their being open for all other hosts to connect to them
and enforce connection level server behavior this way. It is not
possible for an application-level server to restrict its
availability to one remote host by entering a host name here.
REMOTEPORT
Determines which port on the remote machine is used to communicate
across the network. For ‘/inet/tcp’ and ‘/inet/udp’,
application-level clients _must_ use a number other than ‘0’ to
indicate to which port on the remote machine they want to connect.
Application-level servers must not fill this field with a ‘0’.
Instead they specify a local port to which clients connect. It is
possible to use a name from ‘/etc/services’ here.
Experts in network programming will notice that the usual
client/server asymmetry found at the level of the socket API is not
visible here. This is for the sake of simplicity of the high-level
concept. If this asymmetry is necessary for your application, use
another language. For ‘gawk’, it is more important to enable users to
write a client program with a minimum of code. What happens when first
accessing a network connection is seen in the following pseudocode:
if ((name of remote host given) && (other side accepts connection)) {
rendez-vous successful; transmit with getline or print
} else {
if ((other side did not accept) && (localport == 0))
exit unsuccessful
if (TCP) {
set up a server accepting connections
this means waiting for the client on the other side to connect
} else
ready
}
The exact behavior of this algorithm depends on the values of the
fields of the special file name. When in doubt, *note Table 2.1:
table-inet-components. gives you the combinations of values and their
meaning. If this table is too complicated, focus on the three lines
printed in *bold*. All the examples in *note Networking With ‘gawk’:
Using Networking, use only the patterns printed in bold letters.
PROTOCOL LOCAL HOST NAME REMOTE RESULTING CONNECTION-LEVEL
PORT PORT BEHAVIOR
------------------------------------------------------------------------------
*tcp* *0* *x* *x* *Dedicated client, fails if
immediately connecting to a
server on the other side
fails*
udp 0 x x Dedicated client
*tcp, *x* *x* *x* *Client, switches to
udp* dedicated server if
necessary*
*tcp, *x* *0* *0* *Dedicated server*
udp*
tcp, udp x x 0 Invalid
tcp, udp 0 0 x Invalid
tcp, udp x 0 x Invalid
tcp, udp 0 0 0 Invalid
tcp, udp 0 x 0 Invalid
Table 2.1: ‘/inet’ Special File Components
In general, TCP is the preferred mechanism to use. It is the
simplest protocol to understand and to use. Use UDP only if
circumstances demand low-overhead.
2.1.2 Comparing Protocols
-------------------------
This node develops a pair of programs (sender and receiver) that do
nothing but send a timestamp from one machine to another. The sender
and the receiver are implemented with each of the two protocols
available and demonstrate the differences between them.
2.1.2.1 ‘/inet/tcp’
...................
Once again, always use TCP. (Use UDP when low overhead is a necessity.)
The first example is the sender program:
# Server
BEGIN {
print strftime() |& "/inet/tcp/8888/0/0"
close("/inet/tcp/8888/0/0")
}
The receiver is very simple:
# Client
BEGIN {
"/inet/tcp/0/localhost/8888" |& getline
print $0
close("/inet/tcp/0/localhost/8888")
}
TCP guarantees that the bytes arrive at the receiving end in exactly
the same order that they were sent. No byte is lost (except for broken
connections), doubled, or out of order. Some overhead is necessary to
accomplish this, but this is the price to pay for a reliable service.
It does matter which side starts first. The sender/server has to be
started first, and it waits for the receiver to read a line.
2.1.2.2 ‘/inet/udp’
...................
The server and client programs that use UDP are almost identical to
their TCP counterparts; only the PROTOCOL has changed. As before, it
does matter which side starts first. The receiving side blocks and
waits for the sender. In this case, the receiver/client has to be
started first:
# Server
BEGIN {
print strftime() |& "/inet/udp/8888/0/0"
close("/inet/udp/8888/0/0")
}
The receiver is almost identical to the TCP receiver:
# Client
BEGIN {
print "hi!" |& "/inet/udp/0/localhost/8888"
"/inet/udp/0/localhost/8888" |& getline
print $0
close("/inet/udp/0/localhost/8888")
}
In the case of UDP, the initial ‘print’ command is the one that
actually sends data so that there is a connection. UDP and “connection”
sounds strange to anyone who has learned that UDP is a connectionless
protocol. Here, “connection” means that the ‘connect()’ system call has
completed its work and completed the “association” between a certain
socket and an IP address. Thus there are subtle differences between
‘connect()’ for TCP and UDP; see the man page for details.(1)
UDP cannot guarantee that the datagrams at the receiving end will
arrive in exactly the same order they were sent. Some datagrams could
be lost, some doubled, and some could arrive out of order. But no
overhead is necessary to accomplish this. This unreliable behavior is
good enough for tasks such as data acquisition, logging, and even
stateless services like the original versions of NFS.
---------- Footnotes ----------
(1) This subtlety is just one of many details that are hidden in the
socket API, invisible and intractable for the ‘gawk’ user. The
developers are currently considering how to rework the network
facilities to make them easier to understand and use.
2.2 Establishing a TCP Connection
=================================
Let’s observe a network connection at work. Type in the following
program and watch the output. Within a second, it connects via TCP
(‘/inet/tcp’) to a remote server and asks the service ‘daytime’ on the
machine what time it is:
BEGIN {
daytime_server = "time-a-g.nist.gov"
daytime_connection = "/inet/tcp/0/" daytime_server "/daytime"
daytime_connection |& getline
print $0
daytime_connection |& getline
print $0
close(daytime_connection)
}
Even experienced ‘awk’ users will find the fourth and sixth line
strange in two respects:
• A string containing the name of a special file is used as a shell
command that pipes its output into ‘getline’. One would rather
expect to see the special file being read like any other file
(‘getline < "/inet/tcp/0/time-a-g.nist.gov/daytime"’).
• The operator ‘|&’ has not been part of any ‘awk’ implementation
(until now). It is actually the only extension of the ‘awk’
language needed (apart from the special files) to introduce network
access.
The ‘|&’ operator was introduced in ‘gawk’ 3.1 in order to overcome
the crucial restriction that access to files and pipes in ‘awk’ is
always unidirectional. It was formerly impossible to use both access
modes on the same file or pipe. Instead of changing the whole concept
of file access, the ‘|&’ operator behaves exactly like the usual pipe
operator except for two additions:
• Normal shell commands connected to their ‘gawk’ program with a ‘|&’
pipe can be accessed bidirectionally. The ‘|&’ turns out to be a
quite general, useful, and natural extension of ‘awk’.
• Pipes that consist of a special file name for network connections
are not executed as shell commands. Instead, they can be read and
written to, just like a full-duplex network connection.
In the earlier example, the ‘|&’ operator tells ‘getline’ to read a
line from the special file ‘/inet/tcp/0/time-a-g.nist.gov/daytime’. We
could also have printed a line into the special file. But instead we
just consumed an empty leading line, printed it, then read a line with
the time, printed that, and closed the connection. (While we could just
let ‘gawk’ close the connection by finishing the program, in this Info
file we are pedantic and always explicitly close the connections.)
Network services like ‘daytime’ are not really useful because there
are so many better ways to print the current time. In the early days of
TCP networking, such a service may have looked like a good idea for
testing purposes. Later, simple TCP services like these have been used
to teach TCP/IP networking and therefore you can still find much
educational material of good quality on the Internet about such outdated
services. The list of servers (https://tf.nist.gov/tf-cgi/servers.cgi)
that still support the legacy service daytime
(https://en.wikipedia.org/wiki/Daytime_Protocol) can be found at
Wikipedia. We hesitated to use this service in this manual because it
is hard to find servers that still support services like ‘daytime’
openly to the Internet. Later on we will see that some of these
nostalgic protocols have turned into security risks.
2.3 Troubleshooting Connection Problems
=======================================
It may well be that for some reason the program shown in the previous
example does not run on your machine. When looking at possible reasons
for this, you will learn much about typical problems that arise in
network programming.
For the rest of this major node, we will assume you work on a
POSIX-style system that supports TCP/IP. If the previous example program
does not run on your machine, it may help to replace the value assigned
to the variable ‘daytime_server’ with the name (or the IP address) of
another server from the list mentioned above. Now you should see the
date and time being printed by the program, otherwise you may have run
out of servers that support the ‘daytime’ service.
Try changing the service to ‘chargen’ or ‘ftp’. This way, the
program connects to other services that should give you some response.
If you are curious, you should have a look at your ‘/etc/services’ file.
It could look like this:
# /etc/services:
#
# Network services, Internet style
#
# Name Number/Protocol Alternate name # Comments
echo 7/tcp
echo 7/udp
discard 9/tcp sink null
discard 9/udp sink null
daytime 13/tcp
daytime 13/udp
chargen 19/tcp ttytst source
chargen 19/udp ttytst source
ftp 21/tcp
telnet 23/tcp
smtp 25/tcp mail
finger 79/tcp
www 80/tcp http # WorldWideWeb HTTP
www 80/udp # HyperText Transfer Protocol
pop-2 109/tcp postoffice # POP version 2
pop-2 109/udp
pop-3 110/tcp # POP version 3
pop-3 110/udp
nntp 119/tcp readnews untp # USENET News
irc 194/tcp # Internet Relay Chat
irc 194/udp
...
Here, you find a list of services that traditional Unix machines
usually support. If your GNU/Linux machine does not do so, it may be
that these services are switched off in some startup script. Systems
running some flavor of Microsoft Windows usually do _not_ support these
services. Nevertheless, it _is_ possible to do networking with ‘gawk’
on Microsoft Windows.(1) The first column of the file gives the name of
the service, and the second column gives a unique number and the
protocol that one can use to connect to this service. The rest of the
line is treated as a comment. You see that some services (‘echo’)
support TCP as well as UDP.
---------- Footnotes ----------
(1) Microsoft preferred to ignore the TCP/IP family of protocols
until 1995. Then came the rise of the Netscape browser as a landmark
“killer application.” Microsoft added TCP/IP support and their own
browser to Microsoft Windows 95 at the last minute. They even
back-ported their TCP/IP implementation to Microsoft Windows for
Workgroups 3.11, but it was a rather rudimentary and half-hearted
implementation. Nevertheless, the equivalent of ‘/etc/services’ resides
under ‘C:\WINNT\system32\drivers\etc\services’ on Microsoft Windows 2000
and Microsoft Windows XP. On Microsoft Windows 7, 8 and 10 there is a
directory ‘%WinDir%\System32\Drivers\Etc’ that holds the ‘hosts’ file
(https://support.microsoft.com/en-us/help/972034/how-to-reset-the-hosts-file-back-to-the-default)
and probably also a ‘services’ file
(https://www.ibm.com/support/knowledgecenter/SSRNYG_7.2.1/com.ibm.rational.synergy.install.win.doc/topics/sg_r_igw_services_file.html).
2.4 Interacting with a Network Service
======================================
The next program begins really interacting with a network service by
printing something into the special file. It asks the so-called
‘finger’ service if a user of the machine is logged in. When testing
this program, try to change the variable ‘finger_server’ to some other
machine name in your local network:
BEGIN {
finger_server = "andrew.cmu.edu"
finger_connection = "/inet/tcp/0/" finger_server "/finger"
print "wnace" |& finger_connection
while ((finger_connection |& getline) > 0)
print $0
close(finger_connection)
}
After telling the service on the machine which user to look for, the
program repeatedly reads lines that come as a reply. When no more lines
are available (because the service has closed the connection), the
program also closes the connection. If you tried to replace
‘finger_server’ with some other server name, the script probably
reported being unable to open the connection, because most servers today
no longer support this service. Try replacing the login name of
Professor Nace (‘wnace’) with another login name (like ‘help’). You
will receive a list of login names similar to the one you asked for. In
the 1980s you could get a list of all users currently logged in by
asking for an empty string (‘""’).
The final ‘close()’ call could be safely deleted from the above
script, because the operating system closes any open connection by
default when a script reaches the end of execution. But, in order to
avoid portability problems, it is best to always close connections
explicitly. With the Linux kernel, for example, proper closing results
in flushing of buffers. Letting the close happen by default may result
in discarding buffers.
When looking at ‘/etc/services’ you may have noticed that the
‘daytime’ service is also available with ‘udp’. In the earlier
examples, change ‘tcp’ to ‘udp’ and try if the ‘finger’ and ‘daytime’
clients still work as expected. They probably will not respond because
a wise administrator switched off these services. But if they do, you
may see the expected day and time message. The program then hangs,
because it waits for more lines to come from the service. However, they
never do. This behavior is a consequence of the differences between TCP
and UDP. When using UDP, neither party is automatically informed about
the other closing the connection. Continuing to experiment this way
reveals many other subtle differences between TCP and UDP. To avoid such
trouble, you should always remember the advice Douglas E. Comer and
David Stevens give in Volume III of their series ‘Internetworking With
TCP’ (page 14):
When designing client-server applications, beginners are strongly
advised to use TCP because it provides reliable,
connection-oriented communication. Programs only use UDP if the
application protocol handles reliability, the application requires
hardware broadcast or multicast, or the application cannot tolerate
virtual circuit overhead.
This advice is actually quite dated and we hesitated to repeat it
here. But we left it in because we are still observing beginners
running into this pitfall. While this advice has aged quite well, some
other ideas from the 1980s have not. The ‘finger’ service may still be
available in Microsoft Windows Server 2019
(https://docs.microsoft.com/en-us/windows-server/administration/windows-commands/finger),
but it turned out to be a never-ending cause of trouble. First of all,
it is now obvious that a server should never reveal personal data about
its users to anonymous client software that connects over the wild wild
Internet. So every server on the Internet should reject ‘finger’
requests (by disabling the port and by disabling the software serving
this port). But things got even worse in 2020 when it turned out that
even the client software (the ‘finger’ command documented in the link
above) is a security problem. A tool called DarkFinger
(https://seclists.org/fulldisclosure/2020/Sep/30) allows to leverage the
Microsoft Windows ‘finger.exe’ as a file downloader and help evade
network security devices.
2.5 Setting Up a Service
========================
The preceding programs behaved as clients that connect to a server
somewhere on the Internet and request a particular service. Now we set
up such a service to mimic the behavior of the ‘daytime’ service. Such
a server does not know in advance who is going to connect to it over the
network. Therefore, we cannot insert a name for the host to connect to
in our special file name.
Start the following program in one window. Notice that the service
does not have the name ‘daytime’, but the number ‘8888’. From looking
at ‘/etc/services’, you know that names like ‘daytime’ are just
mnemonics for predetermined 16-bit integers. Only the system
administrator (‘root’) could enter our new service into ‘/etc/services’
with an appropriate name. Also notice that the service name has to be
entered into a different field of the special file name because we are
setting up a server, not a client:
BEGIN {
print strftime() |& "/inet/tcp/8888/0/0"
close("/inet/tcp/8888/0/0")
}
Now open another window on the same machine. Copy the client program
given as the first example (*note Establishing a TCP Connection: TCP
Connecting.) to a new file and edit it, changing the variable
‘daytime_server’ to ‘localhost’ and the port name ‘daytime’ to ‘8888’.
Then start the modified client. You should get a reply like this:
$ gawk -f awklib/eg/network/daytimeclient.awk
⊣ Sun Dec 27 17:33:57 CET 2020
⊣ Sun Dec 27 17:33:57 CET 2020
Both programs explicitly close the connection.
Now we will intentionally make a mistake to see what happens when the
name ‘8888’ (the port) is already used by another service. Start the
server program in both windows. The first one works, but the second one
complains that it could not open the connection. Each port on a single
machine can only be used by one server program at a time. Now terminate
the server program and change the name ‘8888’ to ‘echo’. After
restarting it, the server program does not run any more, and you know
why: there is already an ‘echo’ service running on your machine. But
even if this isn’t true, you would not get your own ‘echo’ server
running on a Unix machine, because the ports with numbers smaller than
1024 (‘echo’ is at port 7) are reserved for ‘root’. On machines running
some flavor of Microsoft Windows, there is no restriction that reserves
ports 1 to 1024 for a privileged user; hence, you can start an ‘echo’
server there. Even in later version of Microsoft Windows, this
restriction of the Unix world seems to have never been adopted ‘Does
windows(10/server-2016) have privileged ports?’
(https://social.technet.microsoft.com/Forums/windowsserver/en-US/334f0770-eda9-475a-a27f-46b80ab7e872/does-windows10server2016-have-privileged-ports-?forum=ws2016).
In Microsoft Windows it is the level of the firewall that handles port
access restrictions, not the level of the operating system’s kernel.
Turning this short server program into something really useful is
simple. Imagine a server that first reads a file name from the client
through the network connection, then does something with the file and
sends a result back to the client. The server-side processing could be:
BEGIN {
NetService = "/inet/tcp/8888/0/0"
NetService |& getline # sets $0 and the fields
CatPipe = ("cat " $1)
while ((CatPipe | getline) > 0)
print $0 |& NetService
close(NetService)
}
and we would have a remote copying facility. Such a server reads the
name of a file from any client that connects to it and transmits the
contents of the named file across the net. The server-side processing
could also be the execution of a command that is transmitted across the
network. From this example, you can see how simple it is to open up a
security hole on your machine. If you allow clients to connect to your
machine and execute arbitrary commands, anyone would be free to do ‘rm
-rf *’.
The client side connects to port number 8888 on the server side and
sends the name of the desired file to be sent across the same TCP
connection. The main loop reads all content coming in from the TCP
connection line-wise and prints it.
BEGIN {
NetService = "/inet/tcp/0/localhost/8888"
print "README" |& NetService
while ((NetService |& getline) > 0)
print $0
close(NetService)
}
2.6 Reading Email
=================
The distribution of email is usually done by dedicated email servers
that communicate with your machine using special protocols. In this
node we show how simple the basic steps are.(1)
To receive email, we use the Post Office Protocol (POP). Sending can
be done with the much older Simple Mail Transfer Protocol (SMTP).
When you type in the following program, replace the EMAILHOST by the
name of your local email server. Ask your administrator if the server
has a POP service, and then use its name or number in the program below.
Now the program is ready to connect to your email server, but it will
not succeed in retrieving your mail because it does not yet know your
login name or password. Replace them in the program and it shows you
the first email the server has in store:
BEGIN {
POPService = "/inet/tcp/0/EMAILHOST/pop3"
RS = ORS = "\r\n"
print "user NAME" |& POPService
POPService |& getline
print "pass PASSWORD" |& POPService
POPService |& getline
print "retr 1" |& POPService
POPService |& getline
if ($1 != "+OK") exit
print "quit" |& POPService
RS = "\r\n\\.\r\n"
POPService |& getline
print $0
close(POPService)
}
We redefine the record separators ‘RS’ and ‘ORS’ because the protocol
(POP) requires CR-LF to separate lines. After identifying yourself to
the email service, the command ‘retr 1’ instructs the service to send
the first of all your email messages in line. If the service replies
with something other than ‘+OK’, the program exits; maybe there is no
email. Otherwise, the program first announces that it intends to finish
reading email, and then redefines ‘RS’ in order to read the entire email
as multiline input in one record. From the POP RFC, we know that the
body of the email always ends with a single line containing a single
dot. The program looks for this using ‘RS = "\r\n\\.\r\n"’. When it
finds this sequence in the mail message, it quits. You can invoke this
program as often as you like; it does not delete the message it reads,
but instead leaves it on the server.
---------- Footnotes ----------
(1) No, things are _not_ that simple any more. Things _were_ that
simple when email was young in the 20th century. These days,
unencrypted plaintext authentication is usually disallowed on non-secure
connections. Since encryption of network connections is not supported
in ‘gawk’, you should not use ‘gawk’ to write such scripts. We left
this node as it is because it demonstrates how application level
protocols work in principle (a command being issued by the client
followed by a reply coming back). Unfortunately, modern application
level protocols are much more flexible in the sequence of actions. For
example, modern POP3 servers may introduce themselves with an unprompted
initial line that arrives before the initial command. Dealing with such
variance is not worth the effort in ‘gawk’.
2.7 Reading a Web Page
======================
Retrieving a web page from a web server is as simple as retrieving email
from an email server. We only have to use a similar, but not identical,
protocol and a different port. The name of the protocol is HyperText
Transfer Protocol (HTTP) and the port number is usually 80. As in the
preceding node, ask your administrator about the name of your local web
server or proxy web server and its port number for HTTP requests.
The following program employs a rather crude approach toward
retrieving a web page. It uses the prehistoric syntax of HTTP 0.9,
which almost all web servers still support. The most noticeable thing
about it is that the program directs the request to the local proxy
server whose name you insert in the special file name (which in turn
calls ‘www.yahoo.com’):
BEGIN {
RS = ORS = "\r\n"
HttpService = "/inet/tcp/0/PROXY/80"
print "GET http://www.yahoo.com" |& HttpService
while ((HttpService |& getline) > 0)
print $0
close(HttpService)
}
Again, lines are separated by a redefined ‘RS’ and ‘ORS’. The ‘GET’
request that we send to the server is the only kind of HTTP request that
existed when the web was created in the early 1990s. HTTP calls this
‘GET’ request a “method,” which tells the service to transmit a web page
(here the home page of the Yahoo! search engine). Version 1.0 added
the request methods ‘HEAD’ and ‘POST’. The current version of HTTP is
1.1,(1)(2) and knows the additional request methods ‘OPTIONS’, ‘PUT’,
‘DELETE’, and ‘TRACE’. You can fill in any valid web address, and the
program prints the HTML code of that page to your screen.
Notice the similarity between the responses of the POP and HTTP
services. First, you get a header that is terminated by an empty line,
and then you get the body of the page in HTML. The lines of the headers
also have the same form as in POP. There is the name of a parameter,
then a colon, and finally the value of that parameter.
Images (‘.png’ or ‘.gif’ files) can also be retrieved this way, but
then you get binary data that should be redirected into a file. Another
application is calling a CGI (Common Gateway Interface) script on some
server. CGI scripts are used when the contents of a web page are not
constant, but generated on demand at the moment you send a request for
the page. For example, to get a detailed report about the current
quotes of Motorola stock shares, call a CGI script at Yahoo! with the
following:
get = "GET http://quote.yahoo.com/q?s=MOT&d=t"
print get |& HttpService
You can also request weather reports this way.
---------- Footnotes ----------
(1) Version 1.0 of HTTP was defined in RFC 1945. HTTP 1.1 was
initially specified in RFC 2068. In June 1999, RFC 2068 was made
obsolete by RFC 2616, an update without any substantial changes.
(2) Version 2.0 of HTTP (https://en.wikipedia.org/wiki/HTTP/2) was
defined in RFC7540 (https://tools.ietf.org/html/rfc7540) and was derived
from Google’s SPDY (https://en.wikipedia.org/wiki/SPDY) protocol. It is
said to be widely supported. As of 2020 the most popular web sites
still identify themselves as supporting HTTP/1.1. Version 3.0 of HTTP
(https://en.wikipedia.org/wiki/HTTP/3) is still a draft and was derived
from Google’s QUIC (https://en.wikipedia.org/wiki/QUIC) protocol.
2.8 A Primitive Web Service
===========================
Now we know enough about HTTP to set up a primitive web service that
just says ‘"Hello, world"’ when someone connects to it with a browser.
Compared to the situation in the preceding node, our program changes the
role. It tries to behave just like the server we have observed. Since
we are setting up a server here, we have to insert the port number in
the ‘localport’ field of the special file name. The other two fields
(HOSTNAME and REMOTEPORT) have to contain a ‘0’ because we do not know
in advance which host will connect to our service.
In the early 1990s, all a server had to do was send an HTML document
and close the connection. Here, we adhere to the modern syntax of HTTP.
The steps are as follows:
1. Send a status line telling the web browser that everything is okay.
2. Send a line to tell the browser how many bytes follow in the body
of the message. This was not necessary earlier because both
parties knew that the document ended when the connection closed.
Nowadays it is possible to stay connected after the transmission of
one web page. This avoids the network traffic necessary for
repeatedly establishing TCP connections for requesting several
images. Thus, it is necessary to tell the receiving party how many
bytes will be sent. The header is terminated as usual with an
empty line.
3. Send the ‘"Hello, world"’ body in HTML. The useless ‘while’ loop
swallows the request of the browser. We could actually omit the
loop, and on most machines the program would still work. First,
start the following program:
BEGIN {
RS = ORS = "\r\n"
HttpService = "/inet/tcp/8080/0/0"
Hello = "
" \
"A Famous Greeting" \
"Hello, world
"
Len = length(Hello) + length(ORS)
print "HTTP/1.0 200 OK" |& HttpService
print "Content-Length: " Len ORS |& HttpService
print Hello |& HttpService
while ((HttpService |& getline) > 0)
continue;
close(HttpService)
}
Now, on the same machine, start your favorite browser and let it
point to (the browser needs to know on which
port our server is listening for requests). If this does not work, the
browser probably tries to connect to a proxy server that does not know
your machine. If so, change the browser’s configuration so that the
browser does not try to use a proxy to connect to your machine.
2.9 A Web Service with Interaction
==================================
This node shows how to set up a simple web server. The subnode is a
library file that we will use with all the examples in *note Some
Applications and Techniques::.
Setting up a web service that allows user interaction is more
difficult and shows us the limits of network access in ‘gawk’. In this
node, we develop a main program (a ‘BEGIN’ pattern and its action) that
will become the core of event-driven execution controlled by a graphical
user interface (GUI). Each HTTP event that the user triggers by some
action within the browser is received in this central procedure.
Parameters and menu choices are extracted from this request, and an
appropriate measure is taken according to the user’s choice:
BEGIN {
if (MyHost == "") {
"uname -n" | getline MyHost
close("uname -n")
}
if (MyPort == 0) MyPort = 8080
HttpService = "/inet/tcp/" MyPort "/0/0"
MyPrefix = "http://" MyHost ":" MyPort
SetUpServer()
while ("awk" != "complex") {
# header lines are terminated this way
RS = ORS = "\r\n"
Status = 200 # this means OK
Reason = "OK"
Header = TopHeader
Document = TopDoc
Footer = TopFooter
if (GETARG["Method"] == "GET") {
HandleGET()
} else if (GETARG["Method"] == "HEAD") {
# not yet implemented
} else if (GETARG["Method"] != "") {
print "bad method", GETARG["Method"]
}
Prompt = Header Document Footer
print "HTTP/1.0", Status, Reason |& HttpService
print "Connection: Close" |& HttpService
print "Pragma: no-cache" |& HttpService
len = length(Prompt) + length(ORS)
print "Content-length:", len |& HttpService
print ORS Prompt |& HttpService
# ignore all the header lines
while ((HttpService |& getline) > 0)
;
# stop talking to this client
close(HttpService)
# wait for new client request
HttpService |& getline
# do some logging
print systime(), strftime(), $0
# read request parameters
CGI_setup($1, $2, $3)
}
}
This web server presents menu choices in the form of HTML links.
Therefore, it has to tell the browser the name of the host it is
residing on. When starting the server, the user may supply the name of
the host from the command line with ‘gawk -v MyHost="Rumpelstilzchen"’.
If the user does not do this, the server looks up the name of the host
it is running on for later use as a web address in HTML documents. The
same applies to the port number. These values are inserted later into
the HTML content of the web pages to refer to the home system.
Each server that is built around this core has to initialize some
application-dependent variables (such as the default home page) in a
function ‘SetUpServer()’, which is called immediately before entering
the infinite loop of the server. For now, we will write an instance
that initiates a trivial interaction. With this home page, the client
user can click on two possible choices, and receive the current date
either in human-readable format or in seconds since 1970:
function SetUpServer() {
TopHeader = ""
TopHeader = TopHeader \
"My name is GAWK, GNU AWK"
TopDoc = "\
Do you prefer your date human or \
POSIXed?
" ORS ORS
TopFooter = ""
}
On the first run through the main loop, the default line terminators
are set and the default home page is copied to the actual home page.
Since this is the first run, ‘GETARG["Method"]’ is not initialized yet,
hence the case selection over the method does nothing. Now that the
home page is initialized, the server can start communicating to a client
browser.
It does so by printing the HTTP header into the network connection
(‘print ... |& HttpService’). This command blocks execution of the
server script until a client connects.
If you compare this server script with the primitive one we wrote
before, you will notice two additional lines in the header. The first
instructs the browser to close the connection after each request. The
second tells the browser that it should never try to _remember_ earlier
requests that had identical web addresses (no caching). Otherwise, it
could happen that the browser retrieves the time of day in the previous
example just once, and later it takes the web page from the cache,
always displaying the same time of day although time advances each
second.
Having supplied the initial home page to the browser with a valid
document stored in the parameter ‘Prompt’, it closes the connection and
waits for the next request. When the request comes, a log line is
printed that allows us to see which request the server receives. The
final step in the loop is to call the function ‘CGI_setup()’, which
reads all the lines of the request (coming from the browser), processes
them, and stores the transmitted parameters in the array ‘PARAM’. The
complete text of these application-independent functions can be found in
*note A Simple CGI Library: CGI Lib. For now, we use a simplified
version of ‘CGI_setup()’:
function CGI_setup( method, uri, version, i) {
delete GETARG; delete MENU; delete PARAM
GETARG["Method"] = $1
GETARG["URI"] = $2
GETARG["Version"] = $3
i = index($2, "?")
# is there a "?" indicating a CGI request?
if (i > 0) {
split(substr($2, 1, i-1), MENU, "[/:]")
split(substr($2, i+1), PARAM, "&")
for (i in PARAM) {
j = index(PARAM[i], "=")
GETARG[substr(PARAM[i], 1, j-1)] = \
substr(PARAM[i], j+1)
}
} else { # there is no "?", no need for splitting PARAMs
split($2, MENU, "[/:]")
}
}
At first, the function clears all variables used for global storage
of request parameters. The rest of the function serves the purpose of
filling the global parameters with the extracted new values. To
accomplish this, the name of the requested resource is split into parts
and stored for later evaluation. If the request contains a ‘?’, then
the request has CGI variables seamlessly appended to the web address.
Everything in front of the ‘?’ is split up into menu items, and
everything behind the ‘?’ is a list of ‘VARIABLE=VALUE’ pairs (separated
by ‘&’) that also need splitting. This way, CGI variables are isolated
and stored. This procedure lacks recognition of special characters that
are transmitted in coded form(1). Here, any optional request header and
body parts are ignored. We do not need header parameters and the
request body. However, when refining our approach or working with the
‘POST’ and ‘PUT’ methods, reading the header and body becomes
inevitable. Header parameters should then be stored in a global array
as well as the body.
On each subsequent run through the main loop, one request from a
browser is received, evaluated, and answered according to the user’s
choice. This can be done by letting the value of the HTTP method guide
the main loop into execution of the procedure ‘HandleGET()’, which
evaluates the user’s choice. In this case, we have only one
hierarchical level of menus, but in the general case, menus are nested.
The menu choices at each level are separated by ‘/’, just as in file
names. Notice how simple it is to construct menus of arbitrary depth:
function HandleGET() {
if ( MENU[2] == "human") {
Footer = strftime() TopFooter
} else if (MENU[2] == "POSIX") {
Footer = systime() TopFooter
}
}
The disadvantage of this approach is that our server is slow and can
handle only one request at a time. Its main advantage, however, is that
the server consists of just one ‘gawk’ program. No need for installing
an ‘httpd’, and no need for static separate HTML files, CGI scripts, or
‘root’ privileges. This is rapid prototyping. This program can be
started on the same host that runs your browser. Then let your browser
point to .
It is also possible to include images into the HTML pages. Most
browsers support the not very well-known ‘.xbm’ format, which may
contain only monochrome pictures but is an ASCII format. Binary images
are possible but not so easy to handle. Another way of including images
is to generate them with a tool such as GNUPlot, by calling the tool
with the ‘system()’ function or through a pipe.
---------- Footnotes ----------
(1) As defined in RFC 2068.
2.9.1 A Simple CGI Library
--------------------------
HTTP is like being married: you have to be able to handle whatever
you’re given, while being very careful what you send back.
— _Phil Smith III,
_
In *note A Web Service with Interaction: Interacting Service, we saw
the function ‘CGI_setup()’ as part of the web server “core logic”
framework. The code presented there handles almost everything necessary
for CGI requests. One thing it doesn’t do is handle encoded characters
in the requests. For example, an ‘&’ is encoded as a percent sign
followed by the hexadecimal value: ‘%26’. These encoded values should
be decoded. Following is a simple library to perform these tasks. This
code is used for all web server examples throughout the rest of this
Info file. If you want to use it for your own web server, store the
source code into a file named ‘inetlib.awk’. Then you can include these
functions into your code by placing the following statement into your
program (on the first line of your script):
@include inetlib.awk
But beware, this mechanism is only possible if you invoke your web
server script with ‘igawk’ instead of the usual ‘awk’ or ‘gawk’. Here
is the code:
# CGI Library and core of a web server
# Global arrays
# GETARG --- arguments to CGI GET command
# MENU --- menu items (path names)
# PARAM --- parameters of form x=y
# Optional variable MyHost contains host address
# Optional variable MyPort contains port number
# Needs TopHeader, TopDoc, TopFooter
# Sets MyPrefix, HttpService, Status, Reason
BEGIN {
if (MyHost == "") {
"uname -n" | getline MyHost
close("uname -n")
}
if (MyPort == 0) MyPort = 8080
HttpService = "/inet/tcp/" MyPort "/0/0"
MyPrefix = "http://" MyHost ":" MyPort
SetUpServer()
while ("awk" != "complex") {
# header lines are terminated this way
RS = ORS = "\r\n"
Status = 200 # this means OK
Reason = "OK"
Header = TopHeader
Document = TopDoc
Footer = TopFooter
if (GETARG["Method"] == "GET") {
HandleGET()
} else if (GETARG["Method"] == "HEAD") {
# not yet implemented
} else if (GETARG["Method"] != "") {
print "bad method", GETARG["Method"]
}
Prompt = Header Document Footer
print "HTTP/1.0", Status, Reason |& HttpService
print "Connection: Close" |& HttpService
print "Pragma: no-cache" |& HttpService
len = length(Prompt) + length(ORS)
print "Content-length:", len |& HttpService
print ORS Prompt |& HttpService
# ignore all the header lines
while ((HttpService |& getline) > 0)
continue
# stop talking to this client
close(HttpService)
# wait for new client request
HttpService |& getline
# do some logging
print systime(), strftime(), $0
CGI_setup($1, $2, $3)
}
}
function CGI_setup(method, uri, version, i)
{
delete GETARG
delete MENU
delete PARAM
GETARG["Method"] = method
GETARG["URI"] = uri
GETARG["Version"] = version
i = index(uri, "?")
if (i > 0) { # is there a "?" indicating a CGI request?
split(substr(uri, 1, i-1), MENU, "[/:]")
split(substr(uri, i+1), PARAM, "&")
for (i in PARAM) {
PARAM[i] = _CGI_decode(PARAM[i])
j = index(PARAM[i], "=")
GETARG[substr(PARAM[i], 1, j-1)] = \
substr(PARAM[i], j+1)
}
} else { # there is no "?", no need for splitting PARAMs
split(uri, MENU, "[/:]")
}
for (i in MENU) # decode characters in path
if (i > 4) # but not those in host name
MENU[i] = _CGI_decode(MENU[i])
}
This isolates details in a single function, ‘CGI_setup()’. Decoding
of encoded characters is pushed off to a helper function,
‘_CGI_decode()’. The use of the leading underscore (‘_’) in the
function name is intended to indicate that it is an “internal” function,
although there is nothing to enforce this:
function _CGI_decode(str, hexdigs, i, pre, code1, code2,
val, result)
{
hexdigs = "123456789abcdef"
i = index(str, "%")
if (i == 0) # no work to do
return str
do {
pre = substr(str, 1, i-1) # part before %xx
code1 = substr(str, i+1, 1) # first hex digit
code2 = substr(str, i+2, 1) # second hex digit
str = substr(str, i+3) # rest of string
code1 = tolower(code1)
code2 = tolower(code2)
val = index(hexdigs, code1) * 16 \
+ index(hexdigs, code2)
result = result pre sprintf("%c", val)
i = index(str, "%")
} while (i != 0)
if (length(str) > 0)
result = result str
return result
}
This works by splitting the string apart around an encoded character.
The two digits are converted to lowercase characters and looked up in a
string of hex digits. Note that ‘0’ is not in the string on purpose;
‘index()’ returns zero when it’s not found, automatically giving the
correct value! Once the hexadecimal value is converted from characters
in a string into a numerical value, ‘sprintf()’ converts the value back
into a real character. The following is a simple test harness for the
above functions:
BEGIN {
CGI_setup("GET",
"http://www.gnu.org/cgi-bin/foo?p1=stuff&p2=stuff%26junk" \
"&percent=a %25 sign",
"1.0")
for (i in MENU)
printf "MENU[\"%s\"] = %s\n", i, MENU[i]
for (i in PARAM)
printf "PARAM[\"%s\"] = %s\n", i, PARAM[i]
for (i in GETARG)
printf "GETARG[\"%s\"] = %s\n", i, GETARG[i]
}
And this is the result when we run it:
$ gawk -f testserv.awk
⊣ MENU["4"] = www.gnu.org
⊣ MENU["5"] = cgi-bin
⊣ MENU["6"] = foo
⊣ MENU["1"] = http
⊣ MENU["2"] =
⊣ MENU["3"] =
⊣ PARAM["1"] = p1=stuff
⊣ PARAM["2"] = p2=stuff&junk
⊣ PARAM["3"] = percent=a % sign
⊣ GETARG["p1"] = stuff
⊣ GETARG["percent"] = a % sign
⊣ GETARG["p2"] = stuff&junk
⊣ GETARG["Method"] = GET
⊣ GETARG["Version"] = 1.0
⊣ GETARG["URI"] = http://www.gnu.org/cgi-bin/foo?p1=stuff&
p2=stuff%26junk&percent=a %25 sign
2.10 A Simple Web Server
========================
In the preceding node, we built the core logic for event-driven GUIs.
In this node, we finally extend the core to a real application. No one
would actually write a commercial web server in ‘gawk’, but it is
instructive to see that it is feasible in principle.
The application is ELIZA, the famous program by Joseph Weizenbaum
that mimics the behavior of a professional psychotherapist when talking
to you. Weizenbaum would certainly object to this description, but this
is part of the legend around ELIZA. Take the site-independent core logic
and append the following code:
function SetUpServer() {
SetUpEliza()
TopHeader = \
"An HTTP-based System with GAWK\
\
"
TopDoc = "\
Please choose one of the following actions:
\
"
TopFooter = ""
}
‘SetUpServer()’ is similar to the previous example, except for
calling another function, ‘SetUpEliza()’. This approach can be used to
implement other kinds of servers. The only changes needed to do so are
hidden in the functions ‘SetUpServer()’ and ‘HandleGET()’. Perhaps it
might be necessary to implement other HTTP methods. The ‘igawk’ program
that comes with ‘gawk’ may be useful for this process.
When extending this example to a complete application, the first
thing to do is to implement the function ‘SetUpServer()’ to initialize
the HTML pages and some variables. These initializations determine the
way your HTML pages look (colors, titles, menu items, etc.).
The function ‘HandleGET()’ is a nested case selection that decides
which page the user wants to see next. Each nesting level refers to a
menu level of the GUI. Each case implements a certain action of the
menu. At the deepest level of case selection, the handler essentially
knows what the user wants and stores the answer into the variable that
holds the HTML page contents:
function HandleGET() {
# A real HTTP server would treat some parts of the URI as a file name.
# We take parts of the URI as menu choices and go on accordingly.
if (MENU[2] == "AboutServer") {
Document = "This is not a CGI script.\
This is an httpd, an HTML file, and a CGI script all \
in one GAWK script. It needs no separate www-server, \
no installation, and no root privileges.\
To run it, do this:
\
- start this script with \"gawk -f httpserver.awk\",
\
- and on the same host let your www browser open location\
\"http://localhost:8080\"
\
\\ Details of HTTP come from:
\
- Hethmon: Illustrated Guide to HTTP\
- RFC 2068
JK 14.9.1997
"
} else if (MENU[2] == "AboutELIZA") {
Document = "This is an implementation of the famous ELIZA\
program by Joseph Weizenbaum. It is written in GAWK and\
uses an HTML GUI."
} else if (MENU[2] == "StartELIZA") {
gsub(/\+/, " ", GETARG["YouSay"])
# Here we also have to substitute coded special characters
Document = ""
}
}
Now we are down to the heart of ELIZA, so you can see how it works.
Initially the user does not say anything; then ELIZA resets its money
counter and asks the user to tell what comes to mind open-heartedly.
The subsequent answers are converted to uppercase characters and stored
for later comparison. ELIZA presents the bill when being confronted
with a sentence that contains the phrase “shut up.” Otherwise, it looks
for keywords in the sentence, conjugates the rest of the sentence,
remembers the keyword for later use, and finally selects an answer from
the set of possible answers:
function ElizaSays(YouSay) {
if (YouSay == "") {
cost = 0
answer = "HI, IM ELIZA, TELL ME YOUR PROBLEM"
} else {
q = toupper(YouSay)
gsub("'", "", q)
if (q == qold) {
answer = "PLEASE DONT REPEAT YOURSELF !"
} else {
if (index(q, "SHUT UP") > 0) {
answer = "WELL, PLEASE PAY YOUR BILL. ITS EXACTLY ... $"\
int(100*rand()+30+cost/100)
} else {
qold = q
w = "-" # no keyword recognized yet
for (i in k) { # search for keywords
if (index(q, i) > 0) {
w = i
break
}
}
if (w == "-") { # no keyword, take old subject
w = wold
subj = subjold
} else { # find subject
subj = substr(q, index(q, w) + length(w)+1)
wold = w
subjold = subj # remember keyword and subject
}
for (i in conj)
gsub(i, conj[i], q) # conjugation
# from all answers to this keyword, select one randomly
answer = r[indices[int(split(k[w], indices) * rand()) + 1]]
# insert subject into answer
gsub("_", subj, answer)
}
}
}
cost += length(answer) # for later payment : 1 cent per character
return answer
}
In the long but simple function ‘SetUpEliza()’, you can see tables
for conjugation, keywords, and answers.(1) The associative array ‘k’
contains indices into the array of answers ‘r’. To choose an answer,
ELIZA just picks an index randomly:
function SetUpEliza() {
srand()
wold = "-"
subjold = " "
# table for conjugation
conj[" ARE " ] = " AM "
conj["WERE " ] = "WAS "
conj[" YOU " ] = " I "
conj["YOUR " ] = "MY "
conj[" IVE " ] =\
conj[" I HAVE " ] = " YOU HAVE "
conj[" YOUVE " ] =\
conj[" YOU HAVE "] = " I HAVE "
conj[" IM " ] =\
conj[" I AM " ] = " YOU ARE "
conj[" YOURE " ] =\
conj[" YOU ARE " ] = " I AM "
# table of all answers
r[1] = "DONT YOU BELIEVE THAT I CAN _"
r[2] = "PERHAPS YOU WOULD LIKE TO BE ABLE TO _ ?"
...
# table for looking up answers that
# fit to a certain keyword
k["CAN YOU"] = "1 2 3"
k["CAN I"] = "4 5"
k["YOU ARE"] =\
k["YOURE"] = "6 7 8 9"
...
}
Some interesting remarks and details (including the original source
code of ELIZA) are found on Mark Humphrys’s home page ‘How my program
passed the Turing Test’ (https://computing.dcu.ie/~humphrys/eliza.html).
Wikipedia provides much background information about ELIZA
(https://en.wikipedia.org/wiki/ELIZA), including the original design of
the software and its early implementations.
---------- Footnotes ----------
(1) The version shown here is abbreviated. The full version comes
with the ‘gawk’ distribution.
2.11 Network Programming Caveats
================================
By now it should be clear that debugging a networked application is more
complicated than debugging a single-process single-hosted application.
The behavior of a networked application sometimes looks noncausal
because it is not reproducible in a strong sense. Whether a network
application works or not sometimes depends on the following:
• How crowded the underlying network is
• If the party at the other end is running or not
• The state of the party at the other end
The most difficult problems for a beginner arise from the hidden
states of the underlying network. After closing a TCP connection, it’s
often necessary to wait a short while before reopening the connection.
Even more difficult is the establishment of a connection that previously
ended with a “broken pipe.” Those connections have to “time out” for a
minute or so before they can reopen. Check this with the command
‘netstat -a’, which provides a list of still-active connections.
2.12 Where To Go From Here
==========================
Now, you have learned enough to build your own application. You could,
for example, take part in the Loebner Contest to win $100,000. The
Loebner Prize is the first formal instantiation of a Turing Test. Hugh
Loebner agreed with The Cambridge Center for Behavioral Studies to
underwrite a contest designed to implement the Turing Test. Dr. Loebner
pledged a Grand Prize of $100,000 for the first computer whose responses
were indistinguishable from a human’s. Each year an annual prize of
$2000 and a bronze medal is awarded to the _most_ human computer. The
winner of the annual contest is the best entry relative to other entries
that year, irrespective of how good it is in an absolute sense. Here is
an example of a conversation with the winning program of 1997:
(c)1997 Cambridge Center For Behavioral Studies all rights reserved [CONVERSE]
[Intelligent Research Ltd.] Start at: [1997/04/29 08:59:40]
PROGRAM[10:39:20]Hi, my name is Catherine, what's yours?
JUDGE02[10:39:36]My name is Nathan.
PROGRAM[10:39:37]Well, it's nice to meet you, Nathan.
PROGRAM[10:39:45]Did you see that story on CNN last night about the lesbian
PROGRAM[10:40:03]couple who came out at a White House party on Sunday?
JUDGE02[10:40:45]No. I'm sorry I missed that. How did the Prez take it?
PROGRAM[10:40:47]Ellen Degeneres was one of them - she was kissing her lover
PROGRAM[10:41:08]in front of Bill Clinton. Do you think he was very
PROGRAM[10:41:21]embarrassed?
JUDGE02[10:41:37]You tell me. I didn't see it.
PROGRAM[10:41:38]Are you still a Friend of Bill Clinton?
JUDGE02[10:42:22]Yes. I would like to talk about something else. Do you know anything about sculpture.
PROGRAM[10:42:24]Well, I suppose he's doing his best like most of us, but he
PROGRAM[10:42:35]does seem to attract an UNUSUAL amount of bad publicity,
PROGRAM[10:42:51]wouldnt you say--can it all be bad luck?
JUDGE02[10:43:20]I asked you if you knew anything about sculpture.
PROGRAM[10:43:21]OK, but what happens now--does it all drift on, with
PROGRAM[10:43:36]everyone waiting to see how much his friends have said about
PROGRAM[10:43:47]him under threat of lots and lots of jail-or will something
PROGRAM[10:44:01]dramatic actually happen?
JUDGE02[10:44:19]Do you know what sculpture is?
PROGRAM[10:44:20]Well, youre more a fan of his than I am I guess---though I
PROGRAM[10:44:34]cant SWEAR what Id have done in that locked hotel room, I
PROGRAM[10:44:51]must say.
JUDGE02[10:45:26]Have you ever been to the Salmagundi Club?
PROGRAM[10:45:29]Never. to go back to the original discussion Time to get
PROGRAM[10:45:43]off this one I think and onto something more down to earth!
JUDGE02[10:46:20]What is more down to earth than art?
PROGRAM[10:46:21]I don't know what -- to be honest. -
PROGRAM[10:46:30]I suppose it depends on where you're coming from, but as the
PROGRAM[10:46:46]song goes in My Fair Lady, "Why can't a woman be more like a
PROGRAM[10:47:03]man? "
JUDGE02[10:47:52]I liked that song but I prefer "Why can't children be more like we are"
JUDGE02[10:48:10]from another play the name of which I cannot remember.
PROGRAM[10:48:12]What, if anything, do you enjoy about being a man?
JUDGE02[10:49:01]I would enjoy all aspects of life no matter what my gender.
PROGRAM[10:49:02]Do you think of yourself as being attractive?
This program insists on always speaking about the same story around
Bill Clinton. You see, even a program with a rather narrow mind can
behave so much like a human being that it can win this prize. It is
quite common to let these programs talk to each other via network
connections. But during the competition itself, the program and its
computer have to be present at the place the competition is held. We
all would love to see a ‘gawk’ program win in such an event. Maybe it
is up to you to accomplish this?
Some other ideas for useful networked applications:
• Read the file ‘doc/awkforai.txt’ in earlier ‘gawk’
distributions.(1) It was written by Ronald P. Loui (at the time,
Associate Professor of Computer Science, at Washington University
in St. Louis, ) and summarizes why he taught
‘gawk’ to students of Artificial Intelligence. Here are some
passages from the text:
The GAWK manual can be consumed in a single lab session and
the language can be mastered by the next morning by the
average student. GAWK’s automatic initialization, implicit
coercion, I/O support and lack of pointers forgive many of the
mistakes that young programmers are likely to make. Those who
have seen C but not mastered it are happy to see that GAWK
retains some of the same sensibilities while adding what must
be regarded as spoonsful of syntactic sugar.
...
There are further simple answers. Probably the best is the
fact that increasingly, undergraduate AI programming is
involving the Web. Oren Etzioni (University of Washington,
Seattle) has for a while been arguing that the “softbot” is
replacing the mechanical engineers’ robot as the most
glamorous AI testbed. If the artifact whose behavior needs to
be controlled in an intelligent way is the software agent,
then a language that is well-suited to controlling the
software environment is the appropriate language. That would
imply a scripting language. If the robot is KAREL, then the
right language is “turn left; turn right.” If the robot is
Netscape, then the right language is something that can
generate ‘netscape -remote
'openURL(http://cs.wustl.edu/~loui)'’ with elan.
...
AI programming requires high-level thinking. There have
always been a few gifted programmers who can write high-level
programs in assembly language. Most however need the ambient
abstraction to have a higher floor.
...
Second, inference is merely the expansion of notation. No
matter whether the logic that underlies an AI program is
fuzzy, probabilistic, deontic, defeasible, or deductive, the
logic merely defines how strings can be transformed into other
strings. A language that provides the best support for string
processing in the end provides the best support for logic, for
the exploration of various logics, and for most forms of
symbolic processing that AI might choose to call “reasoning”
instead of “logic.” The implication is that PROLOG, which
saves the AI programmer from having to write a unifier, saves
perhaps two dozen lines of GAWK code at the expense of
strongly biasing the logic and representational expressiveness
of any approach.
Now that ‘gawk’ itself can connect to the Internet, it should be
obvious that it is suitable for writing intelligent web agents.
• ‘awk’ is strong at pattern recognition and string processing. So,
it is well suited to the classic problem of language translation.
A first try could be a program that knows the 100 most frequent
English words and their counterparts in German or French. The
service could be implemented by regularly reading email with the
program above, replacing each word by its translation and sending
the translation back via SMTP. Users would send English email to
their translation service and get back a translated email message
in return. As soon as this works, more effort can be spent on a
real translation program.
• Another dialogue-oriented application (on the verge of ridicule) is
the email “support service.” Troubled customers write an email to
an automatic ‘gawk’ service that reads the email. It looks for
keywords in the mail and assembles a reply email accordingly. By
carefully investigating the email header, and repeating these
keywords through the reply email, it is rather simple to give the
customer a feeling that someone cares. Ideally, such a service
would search a database of previous cases for solutions. If none
exists, the database could, for example, consist of all the
newsgroups, mailing lists and FAQs on the Internet.
---------- Footnotes ----------
(1) The file is no longer distributed with ‘gawk’, since the
copyright on the file is not clear.
3 Some Applications and Techniques
**********************************
In this major node, we look at a number of self-contained scripts, with
an emphasis on concise networking. Along the way, we work towards
creating building blocks that encapsulate often-needed functions of the
networking world, show new techniques that broaden the scope of problems
that can be solved with ‘gawk’, and explore leading edge technology that
may shape the future of networking.
We often refer to the site-independent core of the server that we
built in *note A Simple Web Server: Simple Server. When building new
and nontrivial servers, we always copy this building block and append
new instances of the two functions ‘SetUpServer()’ and ‘HandleGET()’.
This makes a lot of sense, since this scheme of event-driven
execution provides ‘gawk’ with an interface to the most widely accepted
standard for GUIs: the web browser. Now, ‘gawk’ can rival even Tcl/Tk.
Tcl and ‘gawk’ have much in common. Both are simple scripting
languages that allow us to quickly solve problems with short programs.
But Tcl has Tk on top of it, and ‘gawk’ had nothing comparable up to
now. While Tcl needs a large and ever-changing library (Tk, which was
originally bound to the X Window System), ‘gawk’ needs just the
networking interface and some kind of browser on the client’s side.
Besides better portability, the most important advantage of this
approach (embracing well-established standards such HTTP and HTML) is
that _we do not need to change the language_. We let others do the work
of fighting over protocols and standards. We can use HTML, JavaScript,
VRML, or whatever else comes along to do our work.
3.1 PANIC: An Emergency Web Server
==================================
At first glance, the ‘"Hello, world"’ example in *note A Primitive Web
Service: Primitive Service, seems useless. By adding just a few lines,
we can turn it into something useful.
The PANIC program tells everyone who connects that the local site is
not working. When a web server breaks down, it makes a difference if
customers get a strange “network unreachable” message, or a short
message telling them that the server has a problem. In such an
emergency, the hard disk and everything on it (including the regular web
service) may be unavailable. Rebooting the web server off a USB drive
makes sense in this setting.
To use the PANIC program as an emergency web server, all you need are
the ‘gawk’ executable and the program below on a USB drive. By default,
it connects to port 8080. A different value may be supplied on the
command line:
BEGIN {
RS = ORS = "\r\n"
if (MyPort == 0) MyPort = 8080
HttpService = "/inet/tcp/" MyPort "/0/0"
Hello = "Out Of Service" \
"" \
"This site is temporarily out of service." \
"
"
Len = length(Hello) + length(ORS)
while ("awk" != "complex") {
print "HTTP/1.0 200 OK" |& HttpService
print "Content-Length: " Len ORS |& HttpService
print Hello |& HttpService
while ((HttpService |& getline) > 0)
continue;
close(HttpService)
}
}
3.2 GETURL: Retrieving Web Pages
================================
GETURL is a versatile building block for shell scripts that need to
retrieve files from the Internet. It takes a web address as a
command-line parameter and tries to retrieve the contents of this
address. The contents are printed to standard output, while the header
is printed to ‘/dev/stderr’. A surrounding shell script could analyze
the contents and extract the text or the links. An ASCII browser could
be written around GETURL. But more interestingly, web robots are
straightforward to write on top of GETURL. On the Internet, you can find
several programs of the same name that do the same job. They are
usually much more complex internally and at least 10 times as big.
At first, GETURL checks if it was called with exactly one web
address. Then, it checks if the user chose to use a special proxy
server whose name is handed over in a variable. By default, it is
assumed that the local machine serves as proxy. GETURL uses the ‘GET’
method by default to access the web page. By handing over the name of a
different method (such as ‘HEAD’), it is possible to choose a different
behavior. With the ‘HEAD’ method, the user does not receive the body of
the page content, but does receive the header:
BEGIN {
if (ARGC != 2) {
print "GETURL - retrieve Web page via HTTP 1.0"
print "IN:\n the URL as a command-line parameter"
print "PARAM(S):\n -v Proxy=MyProxy"
print "OUT:\n the page content on stdout"
print " the page header on stderr"
print "JK 16.05.1997"
print "ADR 13.08.2000"
exit
}
URL = ARGV[1]; ARGV[1] = ""
if (Proxy == "") Proxy = "127.0.0.1"
if (ProxyPort == 0) ProxyPort = 80
if (Method == "") Method = "GET"
HttpService = "/inet/tcp/0/" Proxy "/" ProxyPort
ORS = RS = "\r\n\r\n"
print Method " " URL " HTTP/1.0" |& HttpService
HttpService |& getline Header
print Header > "/dev/stderr"
while ((HttpService |& getline) > 0)
printf "%s", $0
close(HttpService)
}
This program can be changed as needed, but be careful with the last
lines. Make sure transmission of binary data is not corrupted by
additional line breaks. Even as it is now, the byte sequence
‘"\r\n\r\n"’ would disappear if it were contained in binary data. Don’t
get caught in a trap when trying a quick fix on this one.
3.3 REMCONF: Remote Configuration of Embedded Systems
=====================================================
Today, you often find powerful processors in embedded systems.
Dedicated network routers and controllers for all kinds of machinery are
examples of embedded systems. Processors like the Intel 80x86 or the
AMD Elan are able to run multitasking operating systems, such as XINU or
GNU/Linux in embedded PCs. These systems are small and usually do not
have a keyboard or a display. Therefore it is difficult to set up their
configuration. There are several widespread ways to set them up:
• DIP switches
• Read Only Memories such as EPROMs
• Serial lines or some kind of keyboard
• Network connections via ‘telnet’ or SNMP
• HTTP connections with HTML GUIs
In this node, we look at a solution that uses HTTP connections to
control variables of an embedded system that are stored in a file.
Since embedded systems have tight limits on resources like memory, it is
difficult to employ advanced techniques such as SNMP and HTTP servers.
‘gawk’ fits in quite nicely with its single executable which needs just
a short script to start working. The following program stores the
variables in a file, and a concurrent process in the embedded system may
read the file. The program uses the site-independent part of the simple
web server that we developed in *note A Web Service with Interaction:
Interacting Service. As mentioned there, all we have to do is to write
two new procedures ‘SetUpServer()’ and ‘HandleGET()’:
function SetUpServer() {
TopHeader = "Remote Configuration"
TopDoc = "\
Please choose one of the following actions:
\
"
TopFooter = ""
if (ConfigFile == "") ConfigFile = "config.asc"
}
The function ‘SetUpServer()’ initializes the top level HTML texts as
usual. It also initializes the name of the file that contains the
configuration parameters and their values. In case the user supplies a
name from the command line, that name is used. The file is expected to
contain one parameter per line, with the name of the parameter in column
one and the value in column two.
The function ‘HandleGET()’ reflects the structure of the menu tree as
usual. The first menu choice tells the user what this is all about.
The second choice reads the configuration file line by line and stores
the parameters and their values. Notice that the record separator for
this file is ‘"\n"’, in contrast to the record separator for HTTP. The
third menu choice builds an HTML table to show the contents of the
configuration file just read. The fourth choice does the real work of
changing parameters, and the last one just saves the configuration into
a file:
function HandleGET() {
if (MENU[2] == "AboutServer") {
Document = "This is a GUI for remote configuration of an\
embedded system. It is is implemented as one GAWK script."
} else if (MENU[2] == "ReadConfig") {
RS = "\n"
while ((getline < ConfigFile) > 0)
config[$1] = $2;
close(ConfigFile)
RS = "\r\n"
Document = "Configuration has been read."
} else if (MENU[2] == "CheckConfig") {
Document = ""
for (i in config)
Document = Document "" i " | " \
"" config[i] " |
"
Document = Document "
"
} else if (MENU[2] == "ChangeConfig") {
if ("Param" in GETARG) { # any parameter to set?
if (GETARG["Param"] in config) { # is parameter valid?
config[GETARG["Param"]] = GETARG["Value"]
Document = (GETARG["Param"] " = " GETARG["Value"] ".")
} else {
Document = "Parameter " GETARG["Param"] " is invalid."
}
} else {
Document = ""
}
} else if (MENU[2] == "SaveConfig") {
for (i in config)
printf("%s %s\n", i, config[i]) > ConfigFile
close(ConfigFile)
Document = "Configuration has been saved."
}
}
We could also view the configuration file as a database. From this
point of view, the previous program acts like a primitive database
server. Real SQL database systems also make a service available by
providing a TCP port that clients can connect to. But the application
level protocols they use are usually proprietary and also change from
time to time. This is also true for the protocol that MiniSQL uses.
3.4 URLCHK: Look for Changed Web Pages
======================================
Most people who make heavy use of Internet resources have a large
bookmark file with pointers to interesting web sites. It is impossible
to regularly check by hand if any of these sites have changed. A
program is needed to automatically look at the headers of web pages and
tell which ones have changed. URLCHK does the comparison after using
GETURL with the ‘HEAD’ method to retrieve the header.
Like GETURL, this program first checks that it is called with exactly
one command-line parameter. URLCHK also takes the same command-line
variables ‘Proxy’ and ‘ProxyPort’ as GETURL, because these variables are
handed over to GETURL for each URL that gets checked. The one and only
parameter is the name of a file that contains one line for each URL. In
the first column, we find the URL, and the second and third columns hold
the length of the URL’s body when checked for the two last times. Now,
we follow this plan:
1. Read the URLs from the file and remember their most recent lengths
2. Delete the contents of the file
3. For each URL, check its new length and write it into the file
4. If the most recent and the new length differ, tell the user
It may seem a bit peculiar to read the URLs from a file together with
their two most recent lengths, but this approach has several advantages.
You can call the program again and again with the same file. After
running the program, you can regenerate the changed URLs by extracting
those lines that differ in their second and third columns:
BEGIN {
if (ARGC != 2) {
print "URLCHK - check if URLs have changed"
print "IN:\n the file with URLs as a command-line parameter"
print " file contains URL, old length, new length"
print "PARAMS:\n -v Proxy=MyProxy -v ProxyPort=8080"
print "OUT:\n same as file with URLs"
print "JK 02.03.1998"
exit
}
URLfile = ARGV[1]; ARGV[1] = ""
if (Proxy != "") Proxy = " -v Proxy=" Proxy
if (ProxyPort != "") ProxyPort = " -v ProxyPort=" ProxyPort
while ((getline < URLfile) > 0)
Length[$1] = $3 + 0
close(URLfile) # now, URLfile is read in and can be updated
GetHeader = "gawk " Proxy ProxyPort " -v Method=\"HEAD\" -f geturl.awk "
for (i in Length) {
GetThisHeader = GetHeader i " 2>&1"
while ((GetThisHeader | getline) > 0)
if (toupper($0) ~ /CONTENT-LENGTH/) NewLength = $2 + 0
close(GetThisHeader)
print i, Length[i], NewLength > URLfile
if (Length[i] != NewLength) # report only changed URLs
print i, Length[i], NewLength
}
close(URLfile)
}
Another thing that may look strange is the way GETURL is called.
Before calling GETURL, we have to check if the proxy variables need to
be passed on. If so, we prepare strings that will become part of the
command line later. In ‘GetHeader’, we store these strings together
with the longest part of the command line. Later, in the loop over the
URLs, ‘GetHeader’ is appended with the URL and a redirection operator to
form the command that reads the URL’s header over the Internet. GETURL
always sends the headers to ‘/dev/stderr’. That is the reason why we
need the redirection operator to have the header piped in.
This program is not perfect because it assumes that changing URLs
results in changed lengths, which is not necessarily true. A more
advanced approach is to look at some other header line that holds time
information. But, as always when things get a bit more complicated,
this is left as an exercise to the reader.
3.5 WEBGRAB: Extract Links from a Page
======================================
Sometimes it is necessary to extract links from web pages. Browsers do
it, web robots do it, and sometimes even humans do it. Since we have a
tool like GETURL at hand, we can solve this problem with some help from
the Bourne shell:
BEGIN { RS = "https?://[#%&\\+\\-\\./0-9\\:;\\?A-Z_a-z\\~]*" }
RT != "" {
command = ("gawk -v Proxy=MyProxy -f geturl.awk " RT \
" > doc" NR ".html")
print command
}
Notice that the regular expression for URLs is rather crude. A
precise regular expression is much more complex. But this one works
rather well. One problem is that it is unable to find internal links of
an HTML document. Another problem is that ‘ftp’, ‘telnet’, ‘news’,
‘mailto’, and other kinds of links are missing in the regular
expression. However, it is straightforward to add them, if doing so is
necessary for other tasks.
This program reads an HTML file and prints all the HTTP links that it
finds. It relies on ‘gawk’’s ability to use regular expressions as the
record separator. With ‘RS’ set to a regular expression that matches
links, the second action is executed each time a non-empty link is
found. We can find the matching link itself in ‘RT’.
The action could use the ‘system()’ function to let another GETURL
retrieve the page, but here we use a different approach. This simple
program prints shell commands that can be piped into ‘sh’ for execution.
This way it is possible to first extract the links, wrap shell commands
around them, and pipe all the shell commands into a file. After editing
the file, execution of the file retrieves only those files that we
really need. In case we do not want to edit, we can retrieve all the
pages like this:
gawk -f geturl.awk http://www.suse.de | gawk -f webgrab.awk | sh
After this, you will find the contents of all referenced documents in
files named ‘doc*.html’ even if they do not contain HTML code. The most
annoying thing is that we always have to pass the proxy to GETURL. If
you do not like to see the headers of the web pages appear on the
screen, you can redirect them to ‘/dev/null’. Watching the headers
appear can be quite interesting, because it reveals interesting details
such as which web server the companies use. Now, it is clear how the
clever marketing people use web robots to determine the market shares of
Microsoft and Netscape in the web server market.
Port 80 of any web server is like a small hole in a repellent
firewall. After attaching a browser to port 80, we usually catch a
glimpse of the bright side of the server (its home page). With a tool
like GETURL at hand, we are able to discover some of the more concealed
or even “indecent” services (i.e., lacking conformity to standards of
quality). It can be exciting to see the fancy CGI scripts that lie
there, revealing the inner workings of the server, ready to be called:
• With a command such as:
gawk -f geturl.awk http://any.host.on.the.net/cgi-bin/
some servers give you a directory listing of the CGI files.
Knowing the names, you can try to call some of them and watch for
useful results. Sometimes there are executables in such
directories (such as Perl interpreters) that you may call remotely.
If there are subdirectories with configuration data of the web
server, this can also be quite interesting to read.
• The well-known Apache web server usually has its CGI files in the
directory ‘/cgi-bin’. There you can often find the scripts
‘test-cgi’ and ‘printenv’. Both tell you some things about the
current connection and the installation of the web server. Just
call:
gawk -f geturl.awk http://any.host.on.the.net/cgi-bin/test-cgi
gawk -f geturl.awk http://any.host.on.the.net/cgi-bin/printenv
• Sometimes it is even possible to retrieve system files like the web
server’s log file—possibly containing customer data—or even the
file ‘/etc/passwd’. (We don’t recommend this!)
*Caution:* Although this may sound funny or simply irrelevant, we are
talking about severe security holes. Try to explore your own system
this way and make sure that none of the above reveals too much
information about your system.
3.6 STATIST: Graphing a Statistical Distribution
================================================
0.4 ,------------.------------_------------.------------,
| : : sample 1 :::: |
| : : sample 2 ---- |
0.3 |- : :_ -|
| : ,: `, |
| : / : \ |
0.2 |- : / : \ -|
| : / : \ |
| : / : \ |
0.1 |- : / : \ -|
| : / : \ |
| : ,' : `, |
0 |----------------'-' `-----`----------|
| |
| |
-0.1 |- p(m1=m2) =0.0863798346775753 -|
| |
| |
-0.2 |- p(v1=v2) =0.31647637745891 -|
| |
| |
-0.3 `------------'------------'------------'------------'
-10 5 0 5 10
In the HTTP server examples we’ve shown thus far, we never present an
image to the browser and its user. Presenting images is one task.
Generating images that reflect some user input and presenting these
dynamically generated images is another. In this node, we use GNUPlot
for generating ‘.png’, ‘.ps’, or ‘.gif’ files.(1)
The program we develop takes the statistical parameters of two
samples and computes the t-test statistics. As a result, we get the
probabilities that the means and the variances of both samples are the
same. In order to let the user check plausibility, the program presents
an image of the distributions. The statistical computation follows
‘Numerical Recipes in C: The Art of Scientific Computing’ by William H.
Press, Saul A. Teukolsky, William T. Vetterling, and Brian P. Flannery.
Since ‘gawk’ does not have a built-in function for the computation of
the beta function, we use the ‘ibeta()’ function of GNUPlot. As a side
effect, we learn how to use GNUPlot as a sophisticated calculator. The
comparison of means is done as in ‘tutest’, paragraph 14.2, page 613,
and the comparison of variances is done as in ‘ftest’, page 611 in
‘Numerical Recipes’.
As usual, we take the site-independent code for servers and append
our own functions ‘SetUpServer()’ and ‘HandleGET()’:
function SetUpServer() {
TopHeader = "Statistics with GAWK"
TopDoc = "\
Please choose one of the following actions:
\
"
TopFooter = ""
GnuPlot = "gnuplot 2>&1"
m1=m2=0; v1=v2=1; n1=n2=10
}
Here, you see the menu structure that the user sees. Later, we will
see how the program structure of the ‘HandleGET()’ function reflects the
menu structure. What is missing here is the link for the image we
generate. In an event-driven environment, request, generation, and
delivery of images are separated.
Notice the way we initialize the ‘GnuPlot’ command string for the
pipe. By default, GNUPlot outputs the generated image via standard
output, as well as the results of ‘print’(ed) calculations via standard
error. The redirection causes standard error to be mixed into standard
output, enabling us to read results of calculations with ‘getline’. By
initializing the statistical parameters with some meaningful defaults,
we make sure the user gets an image the first time he uses the program.
Following is the rather long function ‘HandleGET()’, which implements
the contents of this service by reacting to the different kinds of
requests from the browser. Before you start playing with this script,
make sure that your browser supports JavaScript and that it also has
this option switched on. The script uses a short snippet of JavaScript
code for delayed opening of a window with an image. A more detailed
explanation follows:
function HandleGET() {
if (MENU[2] == "AboutServer") {
Document = "This is a GUI for a statistical computation.\
It compares means and variances of two distributions.\
It is implemented as one GAWK script and uses GNUPLOT."
} else if (MENU[2] == "EnterParameters") {
Document = ""
if ("m1" in GETARG) { # are there parameters to compare?
Document = Document ""
m1 = GETARG["m1"]; v1 = GETARG["v1"]; n1 = GETARG["n1"]
m2 = GETARG["m2"]; v2 = GETARG["v2"]; n2 = GETARG["n2"]
t = (m1-m2)/sqrt(v1/n1+v2/n2)
df = (v1/n1+v2/n2)*(v1/n1+v2/n2)/((v1/n1)*(v1/n1)/(n1-1) \
+ (v2/n2)*(v2/n2) /(n2-1))
if (v1>v2) {
f = v1/v2
df1 = n1 - 1
df2 = n2 - 1
} else {
f = v2/v1
df1 = n2 - 1
df2 = n1 - 1
}
print "pt=ibeta(" df/2 ",0.5," df/(df+t*t) ")" |& GnuPlot
print "pF=2.0*ibeta(" df2/2 "," df1/2 "," \
df2/(df2+df1*f) ")" |& GnuPlot
print "print pt, pF" |& GnuPlot
RS="\n"; GnuPlot |& getline; RS="\r\n" # $1 is pt, $2 is pF
print "invsqrt2pi=1.0/sqrt(2.0*pi)" |& GnuPlot
print "nd(x)=invsqrt2pi/sd*exp(-0.5*((x-mu)/sd)**2)" |& GnuPlot
print "set term png small color" |& GnuPlot
#print "set term postscript color" |& GnuPlot
#print "set term gif medium size 320,240" |& GnuPlot
print "set yrange[-0.3:]" |& GnuPlot
print "set label 'p(m1=m2) =" $1 "' at 0,-0.1 left" |& GnuPlot
print "set label 'p(v1=v2) =" $2 "' at 0,-0.2 left" |& GnuPlot
print "plot mu=" m1 ",sd=" sqrt(v1) ", nd(x) title 'sample 1',\
mu=" m2 ",sd=" sqrt(v2) ", nd(x) title 'sample 2'" |& GnuPlot
print "quit" |& GnuPlot
GnuPlot |& getline Image
while ((GnuPlot |& getline) > 0)
Image = Image RS $0
close(GnuPlot)
}
Document = Document "\
Do these samples have the same Gaussian distribution?
\
"
} else if (MENU[2] ~ "Image") {
Reason = "OK" ORS "Content-type: image/png"
#Reason = "OK" ORS "Content-type: application/x-postscript"
#Reason = "OK" ORS "Content-type: image/gif"
Header = Footer = ""
Document = Image
}
}
As usual, we give a short description of the service in the first
menu choice. The third menu choice shows us that generation and
presentation of an image are two separate actions. While the latter
takes place quite instantly in the third menu choice, the former takes
place in the much longer second choice. Image data passes from the
generating action to the presenting action via the variable ‘Image’ that
contains a complete ‘.png’ image, which is otherwise stored in a file.
If you prefer ‘.ps’ or ‘.gif’ images over the default ‘.png’ images, you
may select these options by uncommenting the appropriate lines. But
remember to do so in two places: when telling GNUPlot which kind of
images to generate, and when transmitting the image at the end of the
program.
Looking at the end of the program, the way we pass the ‘Content-type’
to the browser is a bit unusual. It is appended to the ‘OK’ of the
first header line to make sure the type information becomes part of the
header. The other variables that get transmitted across the network are
made empty, because in this case we do not have an HTML document to
transmit, but rather raw image data to contain in the body.
Most of the work is done in the second menu choice. It starts with a
strange JavaScript code snippet. When first implementing this server,
we used a short ‘""’ here. But then
browsers got smarter and tried to improve on speed by requesting the
image and the HTML code at the same time. When doing this, the browser
tries to build up a connection for the image request while the request
for the HTML text is not yet completed. The browser tries to connect to
the ‘gawk’ server on port 8080 while port 8080 is still in use for
transmission of the HTML text. The connection for the image cannot be
built up, so the image appears as “broken” in the browser window. We
solved this problem by telling the browser to open a separate window for
the image, but only after a delay of 1000 milliseconds. By this time,
the server should be ready for serving the next request.
But there is one more subtlety in the JavaScript code. Each time the
JavaScript code opens a window for the image, the name of the image is
appended with a timestamp (‘systime()’). Why this constant change of
name for the image? Initially, we always named the image ‘Image’, but
then the Netscape browser noticed the name had _not_ changed since the
previous request and displayed the previous image (caching behavior).
The server core is implemented so that browsers are told _not_ to cache
anything. Obviously HTTP requests do not always work as expected. One
way to circumvent the cache of such overly smart browsers is to change
the name of the image with each request. These three lines of
JavaScript caused us a lot of trouble.
The rest can be broken down into two phases. At first, we check if
there are statistical parameters. When the program is first started,
there usually are no parameters because it enters the page coming from
the top menu. Then, we only have to present the user a form that he can
use to change statistical parameters and submit them. Subsequently, the
submission of the form causes the execution of the first phase because
_now_ there _are_ parameters to handle.
Now that we have parameters, we know there will be an image
available. Therefore we insert the JavaScript code here to initiate the
opening of the image in a separate window. Then, we prepare some
variables that will be passed to GNUPlot for calculation of the
probabilities. Prior to reading the results, we must temporarily change
‘RS’ because GNUPlot separates lines with newlines. After instructing
GNUPlot to generate a ‘.png’ (or ‘.ps’ or ‘.gif’) image, we initiate the
insertion of some text, explaining the resulting probabilities. The
final ‘plot’ command actually generates the image data. This raw binary
has to be read in carefully without adding, changing, or deleting a
single byte. Hence the unusual initialization of ‘Image’ and completion
with a ‘while’ loop.
When using this server, it soon becomes clear that it is far from
being perfect. It mixes source code of six scripting languages or
protocols:
• GNU ‘awk’ implements a server for the protocol:
• HTTP which transmits:
• HTML text which contains a short piece of:
• JavaScript code opening a separate window.
• A Bourne shell script is used for piping commands into:
• GNUPlot to generate the image to be opened.
After all this work, the GNUPlot image opens in the JavaScript window
where it can be viewed by the user.
It is probably better not to mix up so many different languages. The
result is not very readable. Furthermore, the statistical part of the
server does not take care of invalid input. Among others, using
negative variances causes invalid results.
---------- Footnotes ----------
(1) Due to licensing problems, the default installation of GNUPlot
disables the generation of ‘.gif’ files. If your installed version does
not accept ‘set term gif’, just download and install the most recent
version of GNUPlot and the GD library (https://libgd.github.io/) by
Thomas Boutell. Otherwise you still have the chance to generate some
ASCII-art style images with GNUPlot by using ‘set term dumb’. (We tried
it and it worked.)
3.7 MAZE: Walking Through a Maze In Virtual Reality
===================================================
In the long run, every program becomes rococo, and then rubble.
— _Alan Perlis_
By now, we know how to present arbitrary ‘Content-type’s to a
browser. In this node, our server presents a 3D world to our browser.
The 3D world is described in a scene description language (VRML, Virtual
Reality Modeling Language) that allows us to travel through a
perspective view of a 2D maze with our browser. Browsers with a VRML
plugin enable exploration of this technology. We could do one of those
boring ‘Hello world’ examples here, that are usually presented when
introducing novices to VRML. If you have never written any VRML code,
have a look at the VRML FAQ. Presenting a static VRML scene is a bit
trivial; in order to expose ‘gawk’’s capabilities, we will present a
dynamically generated VRML scene. The function ‘SetUpServer()’ is very
simple because it only sets the default HTML page and initializes the
random number generator. As usual, the surrounding server lets you
browse the maze.
function SetUpServer() {
TopHeader = "Walk through a maze"
TopDoc = "\
Please choose one of the following actions:
\
"
TopFooter = ""
srand()
}
The function ‘HandleGET()’ is a bit longer because it first computes
the maze and afterwards generates the VRML code that is sent across the
network. As shown in the STATIST example (*note STATIST::), we set the
type of the content to VRML and then store the VRML representation of
the maze as the page content. We assume that the maze is stored in a 2D
array. Initially, the maze consists of walls only. Then, we add an
entry and an exit to the maze and let the rest of the work be done by
the function ‘MakeMaze()’. Now, only the wall fields are left in the
maze. By iterating over the these fields, we generate one line of VRML
code for each wall field.
function HandleGET() {
if (MENU[2] == "AboutServer") {
Document = "If your browser has a VRML 2 plugin,\
this server shows you a simple VRML scene."
} else if (MENU[2] == "VRMLtest") {
XSIZE = YSIZE = 11 # initially, everything is wall
for (y = 0; y < YSIZE; y++)
for (x = 0; x < XSIZE; x++)
Maze[x, y] = "#"
delete Maze[0, 1] # entry is not wall
delete Maze[XSIZE-1, YSIZE-2] # exit is not wall
MakeMaze(1, 1)
Document = "\
#VRML V2.0 utf8\n\
Group {\n\
children [\n\
PointLight {\n\
ambientIntensity 0.2\n\
color 0.7 0.7 0.7\n\
location 0.0 8.0 10.0\n\
}\n\
DEF B1 Background {\n\
skyColor [0 0 0, 1.0 1.0 1.0 ]\n\
skyAngle 1.6\n\
groundColor [1 1 1, 0.8 0.8 0.8, 0.2 0.2 0.2 ]\n\
groundAngle [ 1.2 1.57 ]\n\
}\n\
DEF Wall Shape {\n\
geometry Box {size 1 1 1}\n\
appearance Appearance { material Material { diffuseColor 0 0 1 } }\n\
}\n\
DEF Entry Viewpoint {\n\
position 0.5 1.0 5.0\n\
orientation 0.0 0.0 -1.0 0.52\n\
}\n"
for (i in Maze) {
split(i, t, SUBSEP)
Document = Document " Transform { translation "
Document = Document t[1] " 0 -" t[2] " children USE Wall }\n"
}
Document = Document " ] # end of group for world\n}"
Reason = "OK" ORS "Content-type: model/vrml"
Header = Footer = ""
}
}
Finally, we have a look at ‘MakeMaze()’, the function that generates
the ‘Maze’ array. When entered, this function assumes that the array
has been initialized so that each element represents a wall element and
the maze is initially full of wall elements. Only the entrance and the
exit of the maze should have been left free. The parameters of the
function tell us which element must be marked as not being a wall.
After this, we take a look at the four neighboring elements and remember
which we have already treated. Of all the neighboring elements, we take
one at random and walk in that direction. Therefore, the wall element
in that direction has to be removed and then, we call the function
recursively for that element. The maze is only completed if we iterate
the above procedure for _all_ neighboring elements (in random order) and
for our present element by recursively calling the function for the
present element. This last iteration could have been done in a loop,
but it is done much simpler recursively.
Notice that elements with coordinates that are both odd are assumed
to be on our way through the maze and the generating process cannot
terminate as long as there is such an element not being ‘delete’d. All
other elements are potentially part of the wall.
function MakeMaze(x, y) {
delete Maze[x, y] # here we are, we have no wall here
p = 0 # count unvisited fields in all directions
if (x-2 SUBSEP y in Maze) d[p++] = "-x"
if (x SUBSEP y-2 in Maze) d[p++] = "-y"
if (x+2 SUBSEP y in Maze) d[p++] = "+x"
if (x SUBSEP y+2 in Maze) d[p++] = "+y"
if (p>0) { # if there are unvisited fields, go there
p = int(p*rand()) # choose one unvisited field at random
if (d[p] == "-x") { delete Maze[x - 1, y]; MakeMaze(x - 2, y)
} else if (d[p] == "-y") { delete Maze[x, y - 1]; MakeMaze(x, y - 2)
} else if (d[p] == "+x") { delete Maze[x + 1, y]; MakeMaze(x + 2, y)
} else if (d[p] == "+y") { delete Maze[x, y + 1]; MakeMaze(x, y + 2)
} # we are back from recursion
MakeMaze(x, y); # try again while there are unvisited fields
}
}
3.8 MOBAGWHO: a Simple Mobile Agent
===================================
There are two ways of constructing a software design: One way is to
make it so simple that there are obviously no deficiencies, and the
other way is to make it so complicated that there are no obvious
deficiencies.
— _C.A.R. Hoare_
A “mobile agent” is a program that can be dispatched from a computer
and transported to a remote server for execution. This is called
“migration”, which means that a process on another system is started
that is independent from its originator. Ideally, it wanders through a
network while working for its creator or owner. In places like the UMBC
Agent Web, people are quite confident that (mobile) agents are a
software engineering paradigm that enables us to significantly increase
the efficiency of our work. Mobile agents could become the mediators
between users and the networking world. For an unbiased view at this
technology, see the remarkable paper ‘Mobile Agents: Are they a good
idea?’.(1)
When trying to migrate a process from one system to another, a server
process is needed on the receiving side. Depending on the kind of
server process, several ways of implementation come to mind. How the
process is implemented depends upon the kind of server process:
• HTTP can be used as the protocol for delivery of the migrating
process. In this case, we use a common web server as the receiving
server process. A universal CGI script mediates between migrating
process and web server. Each server willing to accept migrating
agents makes this universal service available. HTTP supplies the
‘POST’ method to transfer some data to a file on the web server.
When a CGI script is called remotely with the ‘POST’ method instead
of the usual ‘GET’ method, data is transmitted from the client
process to the standard input of the server’s CGI script. So, to
implement a mobile agent, we must not only write the agent program
to start on the client side, but also the CGI script to receive the
agent on the server side.
• The ‘PUT’ method can also be used for migration. HTTP does not
require a CGI script for migration via ‘PUT’. However, with common
web servers there is no advantage to this solution, because web
servers such as Apache require explicit activation of a special
‘PUT’ script.
• ‘Agent Tcl’ pursues a different course; it relies on a dedicated
server process with a dedicated protocol specialized for receiving
mobile agents.
Our agent example abuses a common web server as a migration tool.
So, it needs a universal CGI script on the receiving side (the web
server). The receiving script is activated with a ‘POST’ request when
placed into a location like ‘/httpd/cgi-bin/PostAgent.sh’.
#!/bin/sh
MobAg=/tmp/MobileAgent.$$
# direct script to mobile agent file
cat > $MobAg
# execute agent concurrently
gawk -f $MobAg $MobAg > /dev/null &
# HTTP header, terminator and body
gawk 'BEGIN { print "\r\nAgent started" }'
rm $MobAg # delete script file of agent
By making its process id (‘$$’) part of the unique file name, the
script avoids conflicts between concurrent instances of the script.
First, all lines from standard input (the mobile agent’s source code)
are copied into this unique file. Then, the agent is started as a
concurrent process and a short message reporting this fact is sent to
the submitting client. Finally, the script file of the mobile agent is
removed because it is no longer needed. Although it is a short script,
there are several noteworthy points:
Security
_There is none_. In fact, the CGI script should never be made
available on a server that is part of the Internet because everyone
would be allowed to execute arbitrary commands with it. This
behavior is acceptable only when performing rapid prototyping.
Self-Reference
Each migrating instance of an agent is started in a way that
enables it to read its own source code from standard input and use
the code for subsequent migrations. This is necessary because it
needs to treat the agent’s code as data to transmit. ‘gawk’ is not
the ideal language for such a job. Lisp and Tcl are more suitable
because they do not make a distinction between program code and
data.
Independence
After migration, the agent is not linked to its former home in any
way. By reporting ‘Agent started’, it waves “Goodbye” to its
origin. The originator may choose to terminate or not.
The originating agent itself is started just like any other
command-line script, and reports the results on standard output. By
letting the name of the original host migrate with the agent, the agent
that migrates to a host far away from its origin can report the result
back home. Having arrived at the end of the journey, the agent
establishes a connection and reports the results. This is the reason
for determining the name of the host with ‘uname -n’ and storing it in
‘MyOrigin’ for later use. We may also set variables with the ‘-v’
option from the command line. This interactivity is only of importance
in the context of starting a mobile agent; therefore this ‘BEGIN’
pattern and its action do not take part in migration:
BEGIN {
if (ARGC != 2) {
print "MOBAG - a simple mobile agent"
print "CALL:\n gawk -f mobag.awk mobag.awk"
print "IN:\n the name of this script as a command-line parameter"
print "PARAM:\n -v MyOrigin=myhost.com"
print "OUT:\n the result on stdout"
print "JK 29.03.1998 01.04.1998"
exit
}
if (MyOrigin == "") {
"uname -n" | getline MyOrigin
close("uname -n")
}
}
Since ‘gawk’ cannot manipulate and transmit parts of the program
directly, the source code is read and stored in strings. Therefore, the
program scans itself for the beginning and the ending of functions.
Each line in between is appended to the code string until the end of the
function has been reached. A special case is this part of the program
itself. It is not a function. Placing a similar framework around it
causes it to be treated like a function. Notice that this mechanism
works for all the functions of the source code, but it cannot guarantee
that the order of the functions is preserved during migration:
#ReadMySelf
/^function / { FUNC = $2 }
/^END/ || /^#ReadMySelf/ { FUNC = $1 }
FUNC != "" { MOBFUN[FUNC] = MOBFUN[FUNC] RS $0 }
(FUNC != "") && (/^}/ || /^#EndOfMySelf/) \
{ FUNC = "" }
#EndOfMySelf
The web server code in *note A Web Service with Interaction:
Interacting Service, was first developed as a site-independent core.
Likewise, the ‘gawk’-based mobile agent starts with an agent-independent
core, to which can be appended application-dependent functions. What
follows is the only application-independent function needed for the
mobile agent:
function migrate(Destination, MobCode, Label) {
MOBVAR["Label"] = Label
MOBVAR["Destination"] = Destination
RS = ORS = "\r\n"
HttpService = "/inet/tcp/0/" Destination
for (i in MOBFUN)
MobCode = (MobCode "\n" MOBFUN[i])
MobCode = MobCode "\n\nBEGIN {"
for (i in MOBVAR)
MobCode = (MobCode "\n MOBVAR[\"" i "\"] = \"" MOBVAR[i] "\"")
MobCode = MobCode "\n}\n"
print "POST /cgi-bin/PostAgent.sh HTTP/1.0" |& HttpService
print "Content-length:", length(MobCode) ORS |& HttpService
printf "%s", MobCode |& HttpService
while ((HttpService |& getline) > 0)
print $0
close(HttpService)
}
The ‘migrate()’ function prepares the aforementioned strings
containing the program code and transmits them to a server. A
consequence of this modular approach is that the ‘migrate()’ function
takes some parameters that aren’t needed in this application, but that
will be in future ones. Its mandatory parameter ‘Destination’ holds the
name (or IP address) of the server that the agent wants as a host for
its code. The optional parameter ‘MobCode’ may contain some ‘gawk’ code
that is inserted during migration in front of all other code. The
optional parameter ‘Label’ may contain a string that tells the agent
what to do in program execution after arrival at its new home site. One
of the serious obstacles in implementing a framework for mobile agents
is that it does not suffice to migrate the code. It is also necessary
to migrate the state of execution of the agent. In contrast to ‘Agent
Tcl’, this program does not try to migrate the complete set of
variables. The following conventions apply:
• Each variable in an agent program is local to the current host and
does _not_ migrate.
• The array ‘MOBFUN’ shown above is an exception. It is handled by
the function ‘migrate()’ and does migrate with the application.
• The other exception is the array ‘MOBVAR’. Each variable that
takes part in migration has to be an element of this array.
‘migrate()’ also takes care of this.
Now it’s clear what happens to the ‘Label’ parameter of the function
‘migrate()’. It is copied into ‘MOBVAR["Label"]’ and travels alongside
the other data. Since traveling takes place via HTTP, records must be
separated with ‘"\r\n"’ in ‘RS’ and ‘ORS’ as usual. The code assembly
for migration takes place in three steps:
• Iterate over ‘MOBFUN’ to collect all functions verbatim.
• Prepare a ‘BEGIN’ pattern and put assignments to mobile variables
into the action part.
• Transmission itself resembles GETURL: the header with the request
and the ‘Content-length’ is followed by the body. In case there is
any reply over the network, it is read completely and echoed to
standard output to avoid irritating the server.
The application-independent framework is now almost complete. What
follows is the ‘END’ pattern which executes when the mobile agent has
finished reading its own code. First, it checks whether it is already
running on a remote host or not. In case initialization has not yet
taken place, it starts ‘MyInit()’. Otherwise (later, on a remote host),
it starts ‘MyJob()’:
END {
if (ARGC != 2) exit # stop when called with wrong parameters
if (MyOrigin != "") # is this the originating host?
MyInit() # if so, initialize the application
else # we are on a host with migrated data
MyJob() # so we do our job
}
All that’s left to extend the framework into a complete application
is to write two application-specific functions: ‘MyInit()’ and
‘MyJob()’. Keep in mind that the former is executed once on the
originating host, while the latter is executed after each migration:
function MyInit() {
MOBVAR["MyOrigin"] = MyOrigin
MOBVAR["Machines"] = "localhost/80 max/80 moritz/80 castor/80"
split(MOBVAR["Machines"], Machines) # which host is the first?
migrate(Machines[1], "", "") # go to the first host
while (("/inet/tcp/8080/0/0" |& getline) > 0) # wait for result
print $0 # print result
close("/inet/tcp/8080/0/0")
}
As mentioned earlier, this agent takes the name of its origin
(‘MyOrigin’) with it. Then, it takes the name of its first destination
and goes there for further work. Notice that this name has the port
number of the web server appended to the name of the server, because the
function ‘migrate()’ needs it this way to create the ‘HttpService’
variable. Finally, it waits for the result to arrive. The ‘MyJob()’
function runs on the remote host:
function MyJob() {
# forget this host
sub(MOBVAR["Destination"], "", MOBVAR["Machines"])
MOBVAR["Result"]=MOBVAR["Result"] SUBSEP SUBSEP MOBVAR["Destination"] ":"
while (("who" | getline) > 0) # who is logged in?
MOBVAR["Result"] = MOBVAR["Result"] SUBSEP $0
close("who")
if (index(MOBVAR["Machines"], "/") > 0) { # any more machines to visit?
split(MOBVAR["Machines"], Machines) # which host is next?
migrate(Machines[1], "", "") # go there
} else { # no more machines
gsub(SUBSEP, "\n", MOBVAR["Result"]) # send result to origin
print MOBVAR["Result"] |& "/inet/tcp/0/" MOBVAR["MyOrigin"] "/8080"
close("/inet/tcp/0/" MOBVAR["MyOrigin"] "/8080")
}
}
After migrating, the first thing to do in ‘MyJob()’ is to delete the
name of the current host from the list of hosts to visit. Now, it is
time to start the real work by appending the host’s name to the result
string, and reading line by line who is logged in on this host. A very
annoying circumstance is the fact that the elements of ‘MOBVAR’ cannot
hold the newline character (‘"\n"’). If they did, migration of this
string would not work because the string wouldn’t obey the syntax rule
for a string in ‘gawk’. ‘SUBSEP’ is used as a temporary replacement.
If the list of hosts to visit holds at least one more entry, the
agent migrates to that place to go on working there. Otherwise, we
replace the ‘SUBSEP’s with a newline character in the resulting string,
and report it to the originating host, whose name is stored in
‘MOBVAR["MyOrigin"]’.
---------- Footnotes ----------
(1)
3.9 STOXPRED: Stock Market Prediction As A Service
==================================================
Far out in the uncharted backwaters of the unfashionable end of the
Western Spiral arm of the Galaxy lies a small unregarded yellow
sun.
Orbiting this at a distance of roughly ninety-two million miles is
an utterly insignificant little blue-green planet whose
ape-descendent life forms are so amazingly primitive that they
still think digital watches are a pretty neat idea.
This planet has — or rather had — a problem, which was this: most
of the people living on it were unhappy for pretty much of the
time. Many solutions were suggested for this problem, but most of
these were largely concerned with the movements of small green
pieces of paper, which is odd because it wasn’t the small green
pieces of paper that were unhappy.
— _Douglas Adams, ‘The Hitch Hiker’s Guide to the Galaxy’_
Valuable services on the Internet are usually _not_ implemented as
mobile agents. There are much simpler ways of implementing services.
All Unix systems provide, for example, the ‘cron’ service. Unix system
users can write a list of tasks to be done each day, each week, twice a
day, or just once. The list is entered into a file named ‘crontab’.
For example, to distribute a newsletter on a daily basis this way, use
‘cron’ for calling a script each day early in the morning:
# run at 8 am on weekdays, distribute the newsletter
0 8 * * 1-5 $HOME/bin/daily.job >> $HOME/log/newsletter 2>&1
The script first looks for interesting information on the Internet,
assembles it in a nice form and sends the results via email to the
customers.
The following is an example of a primitive newsletter on stock market
prediction. It is a report which first tries to predict the change of
each share in the Dow Jones Industrial Index for the particular day.
Then it mentions some especially promising shares as well as some shares
which look remarkably bad on that day. The report ends with the usual
disclaimer which tells every child _not_ to try this at home and hurt
anybody.
Good morning Uncle Scrooge,
This is your daily stock market report for Monday, October 16, 2000.
Here are the predictions for today:
AA neutral
GE up
JNJ down
MSFT neutral
...
UTX up
DD down
IBM up
MO down
WMT up
DIS up
INTC up
MRK down
XOM down
EK down
IP down
The most promising shares for today are these:
INTC http://biz.yahoo.com/n/i/intc.html
The stock shares to avoid today are these:
EK http://biz.yahoo.com/n/e/ek.html
IP http://biz.yahoo.com/n/i/ip.html
DD http://biz.yahoo.com/n/d/dd.html
...
The script as a whole is rather long. In order to ease the pain of
studying other people’s source code, we have broken the script up into
meaningful parts which are invoked one after the other. The basic
structure of the script is as follows:
BEGIN {
Init()
ReadQuotes()
CleanUp()
Prediction()
Report()
SendMail()
}
The earlier parts store data into variables and arrays which are
subsequently used by later parts of the script. The ‘Init()’ function
first checks if the script is invoked correctly (without any
parameters). If not, it informs the user of the correct usage. What
follows are preparations for the retrieval of the historical quote data.
The names of the 30 stock shares are stored in an array ‘name’ along
with the current date in ‘day’, ‘month’, and ‘year’.
All users who are separated from the Internet by a firewall and have
to direct their Internet accesses to a proxy must supply the name of the
proxy to this script with the ‘-v Proxy=NAME’ option. For most users,
the default proxy and port number should suffice.
function Init() {
if (ARGC != 1) {
print "STOXPRED - daily stock share prediction"
print "IN:\n no parameters, nothing on stdin"
print "PARAM:\n -v Proxy=MyProxy -v ProxyPort=80"
print "OUT:\n commented predictions as email"
print "JK 09.10.2000"
exit
}
# Remember ticker symbols from Dow Jones Industrial Index
StockCount = split("AA GE JNJ MSFT AXP GM JPM PG BA HD KO \
SBC C HON MCD T CAT HWP MMM UTX DD IBM MO WMT DIS INTC \
MRK XOM EK IP", name);
# Remember the current date as the end of the time series
day = strftime("%d")
month = strftime("%m")
year = strftime("%Y")
if (Proxy == "") Proxy = "chart.yahoo.com"
if (ProxyPort == 0) ProxyPort = 80
YahooData = "/inet/tcp/0/" Proxy "/" ProxyPort
}
There are two really interesting parts in the script. One is the
function which reads the historical stock quotes from an Internet
server. The other is the one that does the actual prediction. In the
following function we see how the quotes are read from the Yahoo server.
The data which comes from the server is in CSV format (comma-separated
values):
Date,Open,High,Low,Close,Volume
9-Oct-00,22.75,22.75,21.375,22.375,7888500
6-Oct-00,23.8125,24.9375,21.5625,22,10701100
5-Oct-00,24.4375,24.625,23.125,23.50,5810300
Lines contain values of the same time instant, whereas columns are
separated by commas and contain the kind of data that is described in
the header (first) line. At first, ‘gawk’ is instructed to separate
columns by commas (‘FS = ","’). In the loop that follows, a connection
to the Yahoo server is first opened, then a download takes place, and
finally the connection is closed. All this happens once for each ticker
symbol. In the body of this loop, an Internet address is built up as a
string according to the rules of the Yahoo server. The starting and
ending date are chosen to be exactly the same, but one year apart in the
past. All the action is initiated within the ‘printf’ command which
transmits the request for data to the Yahoo server.
In the inner loop, the server’s data is first read and then scanned
line by line. Only lines which have six columns and the name of a month
in the first column contain relevant data. This data is stored in the
two-dimensional array ‘quote’; one dimension being time, the other being
the ticker symbol. During retrieval of the first stock’s data, the
calendar names of the time instances are stored in the array ‘day’
because we need them later.
function ReadQuotes() {
# Retrieve historical data for each ticker symbol
FS = ","
for (stock = 1; stock <= StockCount; stock++) {
URL = "http://chart.yahoo.com/table.csv?s=" name[stock] \
"&a=" month "&b=" day "&c=" year-1 \
"&d=" month "&e=" day "&f=" year \
"g=d&q=q&y=0&z=" name[stock] "&x=.csv"
printf("GET " URL " HTTP/1.0\r\n\r\n") |& YahooData
while ((YahooData |& getline) > 0) {
if (NF == 6 && $1 ~ /Jan|Feb|Mar|Apr|May|Jun|Jul|Aug|Sep|Oct|Nov|Dec/) {
if (stock == 1)
days[++daycount] = $1;
quote[$1, stock] = $5
}
}
close(YahooData)
}
FS = " "
}
Now that we _have_ the data, it can be checked once again to make
sure that no individual stock is missing or invalid, and that all the
stock quotes are aligned correctly. Furthermore, we renumber the time
instances. The most recent day gets day number 1 and all other days get
consecutive numbers. All quotes are rounded toward the nearest whole
number in US Dollars.
function CleanUp() {
# clean up time series; eliminate incomplete data sets
for (d = 1; d <= daycount; d++) {
for (stock = 1; stock <= StockCount; stock++)
if (! ((days[d], stock) in quote))
stock = StockCount + 10
if (stock > StockCount + 1)
continue
datacount++
for (stock = 1; stock <= StockCount; stock++)
data[datacount, stock] = int(0.5 + quote[days[d], stock])
}
delete quote
delete days
}
Now we have arrived at the second really interesting part of the
whole affair. What we present here is a very primitive prediction
algorithm: _If a stock fell yesterday, assume it will also fall today;
if it rose yesterday, assume it will rise today_. (Feel free to replace
this algorithm with a smarter one.) If a stock changed in the same
direction on two consecutive days, this is an indication which should be
highlighted. Two-day advances are stored in ‘hot’ and two-day declines
in ‘avoid’.
The rest of the function is a sanity check. It counts the number of
correct predictions in relation to the total number of predictions one
could have made in the year before.
function Prediction() {
# Predict each ticker symbol by prolonging yesterday's trend
for (stock = 1; stock <= StockCount; stock++) {
if (data[1, stock] > data[2, stock]) {
predict[stock] = "up"
} else if (data[1, stock] < data[2, stock]) {
predict[stock] = "down"
} else {
predict[stock] = "neutral"
}
if ((data[1, stock] > data[2, stock]) && (data[2, stock] > data[3, stock]))
hot[stock] = 1
if ((data[1, stock] < data[2, stock]) && (data[2, stock] < data[3, stock]))
avoid[stock] = 1
}
# Do a plausibility check: how many predictions proved correct?
for (s = 1; s <= StockCount; s++) {
for (d = 1; d <= datacount-2; d++) {
if (data[d+1, s] > data[d+2, s]) {
UpCount++
} else if (data[d+1, s] < data[d+2, s]) {
DownCount++
} else {
NeutralCount++
}
if (((data[d, s] > data[d+1, s]) && (data[d+1, s] > data[d+2, s])) ||
((data[d, s] < data[d+1, s]) && (data[d+1, s] < data[d+2, s])) ||
((data[d, s] == data[d+1, s]) && (data[d+1, s] == data[d+2, s])))
CorrectCount++
}
}
}
At this point the hard work has been done: the array ‘predict’
contains the predictions for all the ticker symbols. It is up to the
function ‘Report()’ to find some nice words to present the desired
information.
function Report() {
# Generate report
report = "\nThis is your daily "
report = report "stock market report for "strftime("%A, %B %d, %Y")".\n"
report = report "Here are the predictions for today:\n\n"
for (stock = 1; stock <= StockCount; stock++)
report = report "\t" name[stock] "\t" predict[stock] "\n"
for (stock in hot) {
if (HotCount++ == 0)
report = report "\nThe most promising shares for today are these:\n\n"
report = report "\t" name[stock] "\t\thttp://biz.yahoo.com/n/" \
tolower(substr(name[stock], 1, 1)) "/" tolower(name[stock]) ".html\n"
}
for (stock in avoid) {
if (AvoidCount++ == 0)
report = report "\nThe stock shares to avoid today are these:\n\n"
report = report "\t" name[stock] "\t\thttp://biz.yahoo.com/n/" \
tolower(substr(name[stock], 1, 1)) "/" tolower(name[stock]) ".html\n"
}
report = report "\nThis sums up to " HotCount+0 " winners and " AvoidCount+0
report = report " losers. When using this kind\nof prediction scheme for"
report = report " the 12 months which lie behind us,\nwe get " UpCount
report = report " 'ups' and " DownCount " 'downs' and " NeutralCount
report = report " 'neutrals'. Of all\nthese " UpCount+DownCount+NeutralCount
report = report " predictions " CorrectCount " proved correct next day.\n"
report = report "A success rate of "\
int(100*CorrectCount/(UpCount+DownCount+NeutralCount)) "%.\n"
report = report "Random choice would have produced a 33% success rate.\n"
report = report "Disclaimer: Like every other prediction of the stock\n"
report = report "market, this report is, of course, complete nonsense.\n"
report = report "If you are stupid enough to believe these predictions\n"
report = report "you should visit a doctor who can treat your ailment."
}
The function ‘SendMail()’ goes through the list of customers and
opens a pipe to the ‘mail’ command for each of them. Each one receives
an email message with a proper subject heading and is addressed with his
full name.
function SendMail() {
# send report to customers
customer["uncle.scrooge@ducktown.gov"] = "Uncle Scrooge"
customer["more@utopia.org" ] = "Sir Thomas More"
customer["spinoza@denhaag.nl" ] = "Baruch de Spinoza"
customer["marx@highgate.uk" ] = "Karl Marx"
customer["keynes@the.long.run" ] = "John Maynard Keynes"
customer["bierce@devil.hell.org" ] = "Ambrose Bierce"
customer["laplace@paris.fr" ] = "Pierre Simon de Laplace"
for (c in customer) {
MailPipe = "mail -s 'Daily Stock Prediction Newsletter'" c
print "Good morning " customer[c] "," | MailPipe
print report "\n.\n" | MailPipe
close(MailPipe)
}
}
Be patient when running the script by hand. Retrieving the data for
all the ticker symbols and sending the emails may take several minutes
to complete, depending upon network traffic and the speed of the
available Internet link. The quality of the prediction algorithm is
likely to be disappointing. Try to find a better one. Should you find
one with a success rate of more than 50%, please tell us about it! It
is only for the sake of curiosity, of course. ‘:-)’
3.10 PROTBASE: Searching Through A Protein Database
===================================================
Inside every large problem is a small problem struggling to get
out.(1)
— _With apologies to C.A.R. Hoare_
Yahoo’s database of stock market data is just one among the many
large databases on the Internet. Another one is located at NCBI
(National Center for Biotechnology Information). Established in 1988 as
a national resource for molecular biology information, NCBI creates
public databases, conducts research in computational biology, develops
software tools for analyzing genome data, and disseminates biomedical
information. In this section, we look at one of NCBI’s public services,
which is called BLAST (Basic Local Alignment Search Tool).
You probably know that the information necessary for reproducing
living cells is encoded in the genetic material of the cells. The
genetic material is a very long chain of four base nucleotides. It is
the order of appearance (the sequence) of nucleotides which contains the
information about the substance to be produced. Scientists in
biotechnology often find a specific fragment, determine the nucleotide
sequence, and need to know where the sequence at hand comes from.
This is where the large databases enter the game. At NCBI, databases
store the knowledge about which sequences have ever been found and where
they have been found. When the scientist sends his sequence to the
BLAST service, the server looks for regions of genetic material in its
database which look the most similar to the delivered nucleotide
sequence. After a search time of some seconds or minutes the server
sends an answer to the scientist. In order to make access simple, NCBI
chose to offer their database service through popular Internet
protocols. There are four basic ways to use the so-called BLAST
services:
• The easiest way to use BLAST is through the web. Users may simply
point their browsers at the NCBI home page and link to the BLAST
pages. NCBI provides a stable URL that may be used to perform
BLAST searches without interactive use of a web browser. This is
what we will do later in this section. A demonstration client and
a ‘README’ file demonstrate how to access this URL.
• Currently, ‘blastcl3’ is the standard network BLAST client. You
can download ‘blastcl3’ from the anonymous FTP location.
• BLAST 2.0 can be run locally as a full executable and can be used
to run BLAST searches against private local databases, or
downloaded copies of the NCBI databases. BLAST 2.0 executables may
be found on the NCBI anonymous FTP server.
• The NCBI BLAST Email server is the best option for people without
convenient access to the web. A similarity search can be performed
by sending a properly formatted mail message containing the
nucleotide or protein query sequence to .
The query sequence is compared against the specified database using
the BLAST algorithm and the results are returned in an email
message. For more information on formulating email BLAST searches,
you can send a message consisting of the word “HELP” to the same
address, .
Our starting point is the demonstration client mentioned in the first
option. The ‘README’ file that comes along with the client explains the
whole process in a nutshell. In the rest of this section, we first show
what such requests look like. Then we show how to use ‘gawk’ to
implement a client in about 10 lines of code. Finally, we show how to
interpret the result returned from the service.
Sequences are expected to be represented in the standard IUB/IUPAC
amino acid and nucleic acid codes, with these exceptions: lower-case
letters are accepted and are mapped into upper-case; a single hyphen or
dash can be used to represent a gap of indeterminate length; and in
amino acid sequences, ‘U’ and ‘*’ are acceptable letters (see below).
Before submitting a request, any numerical digits in the query sequence
should either be removed or replaced by appropriate letter codes (e.g.,
‘N’ for unknown nucleic acid residue or ‘X’ for unknown amino acid
residue). The nucleic acid codes supported are:
A --> adenosine M --> A C (amino)
C --> cytidine S --> G C (strong)
G --> guanine W --> A T (weak)
T --> thymidine B --> G T C
U --> uridine D --> G A T
R --> G A (purine) H --> A C T
Y --> T C (pyrimidine) V --> G C A
K --> G T (keto) N --> A G C T (any)
- gap of indeterminate length
Now you know the alphabet of nucleotide sequences. The last two
lines of the following example query show such a sequence, which is
obviously made up only of elements of the alphabet just described.
Store this example query into a file named ‘protbase.request’. You are
now ready to send it to the server with the demonstration client.
PROGRAM blastn
DATALIB month
EXPECT 0.75
BEGIN
>GAWK310 the gawking gene GNU AWK
tgcttggctgaggagccataggacgagagcttcctggtgaagtgtgtttcttgaaatcat
caccaccatggacagcaaa
The actual search request begins with the mandatory parameter
‘PROGRAM’ in the first column followed by the value ‘blastn’ (the name
of the program) for searching nucleic acids. The next line contains the
mandatory search parameter ‘DATALIB’ with the value ‘month’ for the
newest nucleic acid sequences. The third line contains an optional
‘EXPECT’ parameter and the value desired for it. The fourth line
contains the mandatory ‘BEGIN’ directive, followed by the query sequence
in FASTA/Pearson format. Each line of information must be less than 80
characters in length.
The “month” database contains all new or revised sequences released
in the last 30 days and is useful for searching against new sequences.
There are five different blast programs, ‘blastn’ being the one that
compares a nucleotide query sequence against a nucleotide sequence
database.
The last server directive that must appear in every request is the
‘BEGIN’ directive. The query sequence should immediately follow the
‘BEGIN’ directive and must appear in FASTA/Pearson format. A sequence
in FASTA/Pearson format begins with a single-line description. The
description line, which is required, is distinguished from the lines of
sequence data that follow it by having a greater-than (‘>’) symbol in
the first column. For the purposes of the BLAST server, the text of the
description is arbitrary.
If you prefer to use a client written in ‘gawk’, just store the
following 10 lines of code into a file named ‘protbase.awk’ and use this
client instead. Invoke it with ‘gawk -f protbase.awk protbase.request’.
Then wait a minute and watch the result coming in. In order to
replicate the demonstration client’s behavior as closely as possible,
this client does not use a proxy server. We could also have extended
the client program in *note Retrieving Web Pages: GETURL, to implement
the client request from ‘protbase.awk’ as a special case.
{ request = request "\n" $0 }
END {
BLASTService = "/inet/tcp/0/www.ncbi.nlm.nih.gov/80"
printf "POST /cgi-bin/BLAST/nph-blast_report HTTP/1.0\n" |& BLASTService
printf "Content-Length: " length(request) "\n\n" |& BLASTService
printf request |& BLASTService
while ((BLASTService |& getline) > 0)
print $0
close(BLASTService)
}
The demonstration client from NCBI is 214 lines long (written in C)
and it is not immediately obvious what it does. Our client is so short
that it _is_ obvious what it does. First it loops over all lines of the
query and stores the whole query into a variable. Then the script
establishes an Internet connection to the NCBI server and transmits the
query by framing it with a proper HTTP request. Finally it receives and
prints the complete result coming from the server.
Now, let us look at the result. It begins with an HTTP header, which
you can ignore. Then there are some comments about the query having
been filtered to avoid spuriously high scores. After this, there is a
reference to the paper that describes the software being used for
searching the data base. After a repetition of the original query’s
description we find the list of significant alignments:
Sequences producing significant alignments: (bits) Value
gb|AC021182.14|AC021182 Homo sapiens chromosome 7 clone RP11-733... 38 0.20
gb|AC021056.12|AC021056 Homo sapiens chromosome 3 clone RP11-115... 38 0.20
emb|AL160278.10|AL160278 Homo sapiens chromosome 9 clone RP11-57... 38 0.20
emb|AL391139.11|AL391139 Homo sapiens chromosome X clone RP11-35... 38 0.20
emb|AL365192.6|AL365192 Homo sapiens chromosome 6 clone RP3-421H... 38 0.20
emb|AL138812.9|AL138812 Homo sapiens chromosome 11 clone RP1-276... 38 0.20
gb|AC073881.3|AC073881 Homo sapiens chromosome 15 clone CTD-2169... 38 0.20
This means that the query sequence was found in seven human
chromosomes. But the value 0.20 (20%) means that the probability of an
accidental match is rather high (20%) in all cases and should be taken
into account. You may wonder what the first column means. It is a key
to the specific database in which this occurrence was found. The unique
sequence identifiers reported in the search results can be used as
sequence retrieval keys via the NCBI server. The syntax of sequence
header lines used by the NCBI BLAST server depends on the database from
which each sequence was obtained. The table below lists the identifiers
for the databases from which the sequences were derived.
Database Name Identifier Syntax
============================ ========================
GenBank gb|accession|locus
EMBL Data Library emb|accession|locus
DDBJ, DNA Database of Japan dbj|accession|locus
NBRF PIR pir||entry
Protein Research Foundation prf||name
SWISS-PROT sp|accession|entry name
Brookhaven Protein Data Bank pdb|entry|chain
Kabat's Sequences of Immuno... gnl|kabat|identifier
Patents pat|country|number
GenInfo Backbone Id bbs|number
For example, an identifier might be ‘gb|AC021182.14|AC021182’, where
the ‘gb’ tag indicates that the identifier refers to a GenBank sequence,
‘AC021182.14’ is its GenBank ACCESSION, and ‘AC021182’ is the GenBank
LOCUS. The identifier contains no spaces, so that a space indicates the
end of the identifier.
Let us continue in the result listing. Each of the seven alignments
mentioned above is subsequently described in detail. We will have a
closer look at the first of them.
>gb|AC021182.14|AC021182 Homo sapiens chromosome 7 clone RP11-733N23, WORKING DRAFT SEQUENCE, 4
unordered pieces
Length = 176383
Score = 38.2 bits (19), Expect = 0.20
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 35 tggtgaagtgtgtttcttg 53
|||||||||||||||||||
Sbjct: 69786 tggtgaagtgtgtttcttg 69804
This alignment was located on the human chromosome 7. The fragment
on which part of the query was found had a total length of 176383. Only
19 of the nucleotides matched and the matching sequence ran from
character 35 to 53 in the query sequence and from 69786 to 69804 in the
fragment on chromosome 7. If you are still reading at this point, you
are probably interested in finding out more about Computational Biology
and you might appreciate the following hints.
1. There is a book called ‘Introduction to Computational Biology’ by
Michael S. Waterman, which is worth reading if you are seriously
interested. You can find a good book review on the Internet.
2. While Waterman’s book explains the algorithms employed internally
in the database search engines, most practitioners prefer to
approach the subject differently. The applied side of
Computational Biology is called Bioinformatics, and emphasizes the
tools available for day-to-day work as well as how to actually
_use_ them. One of the very few affordable books on Bioinformatics
is ‘Developing Bioinformatics Computer Skills’.
3. The sequences _gawk_ and _gnuawk_ are in widespread use in the
genetic material of virtually every earthly living being. Let us
take this as a clear indication that the divine creator has
intended ‘gawk’ to prevail over other scripting languages such as
‘perl’, ‘tcl’, or ‘python’ which are not even proper sequences.
(:-)
---------- Footnotes ----------
(1) What C.A.R. Hoare actually said was “Inside every large program
is a small program struggling to get out.”
4 Related Links
***************
This section lists the URLs for various items discussed in this Info
file. They are presented in the order in which they appear.
‘Internet Programming with Python’
‘Advanced Perl Programming’
‘Web Client Programming with Perl’
Richard Stevens’s home page and book
Volume III of ‘Internetworking with TCP/IP’, by Comer and Stevens
XBM Graphics File Format
GNUPlot
Mark Humphrys’ Eliza page
Eliza on Wikipedia
Java versions of Eliza with source code
Loebner Contest
Tck/Tk Information
Intel 80x86 Processors
Embedded PCs
AMD Elan Processors
XINU
GNU/Linux
MiniSQL
Market Share Surveys
‘Numerical Recipes in C: The Art of Scientific Computing’
VRML
The UMBC Agent Web
Apache Web Server
National Center for Biotechnology Information (NCBI)
Basic Local Alignment Search Tool (BLAST)
BLAST Pages
BLAST Demonstration Client
BLAST anonymous FTP location
BLAST 2.0 Executables
IUB/IUPAC Amino Acid and Nucleic Acid Codes
FASTA/Pearson Format
Fasta/Pearson Sequence in Java
Book Review of ‘Introduction to Computational Biology’
‘Developing Bioinformatics Computer Skills’
GNU Free Documentation License
******************************
Version 1.3, 3 November 2008
Copyright © 2000, 2001, 2002, 2007, 2008 Free Software Foundation, Inc.
Everyone is permitted to copy and distribute verbatim copies
of this license document, but changing it is not allowed.
0. PREAMBLE
The purpose of this License is to make a manual, textbook, or other
functional and useful document “free” in the sense of freedom: to
assure everyone the effective freedom to copy and redistribute it,
with or without modifying it, either commercially or
noncommercially. Secondarily, this License preserves for the
author and publisher a way to get credit for their work, while not
being considered responsible for modifications made by others.
This License is a kind of “copyleft”, which means that derivative
works of the document must themselves be free in the same sense.
It complements the GNU General Public License, which is a copyleft
license designed for free software.
We have designed this License in order to use it for manuals for
free software, because free software needs free documentation: a
free program should come with manuals providing the same freedoms
that the software does. But this License is not limited to
software manuals; it can be used for any textual work, regardless
of subject matter or whether it is published as a printed book. We
recommend this License principally for works whose purpose is
instruction or reference.
1. APPLICABILITY AND DEFINITIONS
This License applies to any manual or other work, in any medium,
that contains a notice placed by the copyright holder saying it can
be distributed under the terms of this License. Such a notice
grants a world-wide, royalty-free license, unlimited in duration,
to use that work under the conditions stated herein. The
“Document”, below, refers to any such manual or work. Any member
of the public is a licensee, and is addressed as “you”. You accept
the license if you copy, modify or distribute the work in a way
requiring permission under copyright law.
A “Modified Version” of the Document means any work containing the
Document or a portion of it, either copied verbatim, or with
modifications and/or translated into another language.
A “Secondary Section” is a named appendix or a front-matter section
of the Document that deals exclusively with the relationship of the
publishers or authors of the Document to the Document’s overall
subject (or to related matters) and contains nothing that could
fall directly within that overall subject. (Thus, if the Document
is in part a textbook of mathematics, a Secondary Section may not
explain any mathematics.) The relationship could be a matter of
historical connection with the subject or with related matters, or
of legal, commercial, philosophical, ethical or political position
regarding them.
The “Invariant Sections” are certain Secondary Sections whose
titles are designated, as being those of Invariant Sections, in the
notice that says that the Document is released under this License.
If a section does not fit the above definition of Secondary then it
is not allowed to be designated as Invariant. The Document may
contain zero Invariant Sections. If the Document does not identify
any Invariant Sections then there are none.
The “Cover Texts” are certain short passages of text that are
listed, as Front-Cover Texts or Back-Cover Texts, in the notice
that says that the Document is released under this License. A
Front-Cover Text may be at most 5 words, and a Back-Cover Text may
be at most 25 words.
A “Transparent” copy of the Document means a machine-readable copy,
represented in a format whose specification is available to the
general public, that is suitable for revising the document
straightforwardly with generic text editors or (for images composed
of pixels) generic paint programs or (for drawings) some widely
available drawing editor, and that is suitable for input to text
formatters or for automatic translation to a variety of formats
suitable for input to text formatters. A copy made in an otherwise
Transparent file format whose markup, or absence of markup, has
been arranged to thwart or discourage subsequent modification by
readers is not Transparent. An image format is not Transparent if
used for any substantial amount of text. A copy that is not
“Transparent” is called “Opaque”.
Examples of suitable formats for Transparent copies include plain
ASCII without markup, Texinfo input format, LaTeX input format,
SGML or XML using a publicly available DTD, and standard-conforming
simple HTML, PostScript or PDF designed for human modification.
Examples of transparent image formats include PNG, XCF and JPG.
Opaque formats include proprietary formats that can be read and
edited only by proprietary word processors, SGML or XML for which
the DTD and/or processing tools are not generally available, and
the machine-generated HTML, PostScript or PDF produced by some word
processors for output purposes only.
The “Title Page” means, for a printed book, the title page itself,
plus such following pages as are needed to hold, legibly, the
material this License requires to appear in the title page. For
works in formats which do not have any title page as such, “Title
Page” means the text near the most prominent appearance of the
work’s title, preceding the beginning of the body of the text.
The “publisher” means any person or entity that distributes copies
of the Document to the public.
A section “Entitled XYZ” means a named subunit of the Document
whose title either is precisely XYZ or contains XYZ in parentheses
following text that translates XYZ in another language. (Here XYZ
stands for a specific section name mentioned below, such as
“Acknowledgements”, “Dedications”, “Endorsements”, or “History”.)
To “Preserve the Title” of such a section when you modify the
Document means that it remains a section “Entitled XYZ” according
to this definition.
The Document may include Warranty Disclaimers next to the notice
which states that this License applies to the Document. These
Warranty Disclaimers are considered to be included by reference in
this License, but only as regards disclaiming warranties: any other
implication that these Warranty Disclaimers may have is void and
has no effect on the meaning of this License.
2. VERBATIM COPYING
You may copy and distribute the Document in any medium, either
commercially or noncommercially, provided that this License, the
copyright notices, and the license notice saying this License
applies to the Document are reproduced in all copies, and that you
add no other conditions whatsoever to those of this License. You
may not use technical measures to obstruct or control the reading
or further copying of the copies you make or distribute. However,
you may accept compensation in exchange for copies. If you
distribute a large enough number of copies you must also follow the
conditions in section 3.
You may also lend copies, under the same conditions stated above,
and you may publicly display copies.
3. COPYING IN QUANTITY
If you publish printed copies (or copies in media that commonly
have printed covers) of the Document, numbering more than 100, and
the Document’s license notice requires Cover Texts, you must
enclose the copies in covers that carry, clearly and legibly, all
these Cover Texts: Front-Cover Texts on the front cover, and
Back-Cover Texts on the back cover. Both covers must also clearly
and legibly identify you as the publisher of these copies. The
front cover must present the full title with all words of the title
equally prominent and visible. You may add other material on the
covers in addition. Copying with changes limited to the covers, as
long as they preserve the title of the Document and satisfy these
conditions, can be treated as verbatim copying in other respects.
If the required texts for either cover are too voluminous to fit
legibly, you should put the first ones listed (as many as fit
reasonably) on the actual cover, and continue the rest onto
adjacent pages.
If you publish or distribute Opaque copies of the Document
numbering more than 100, you must either include a machine-readable
Transparent copy along with each Opaque copy, or state in or with
each Opaque copy a computer-network location from which the general
network-using public has access to download using public-standard
network protocols a complete Transparent copy of the Document, free
of added material. If you use the latter option, you must take
reasonably prudent steps, when you begin distribution of Opaque
copies in quantity, to ensure that this Transparent copy will
remain thus accessible at the stated location until at least one
year after the last time you distribute an Opaque copy (directly or
through your agents or retailers) of that edition to the public.
It is requested, but not required, that you contact the authors of
the Document well before redistributing any large number of copies,
to give them a chance to provide you with an updated version of the
Document.
4. MODIFICATIONS
You may copy and distribute a Modified Version of the Document
under the conditions of sections 2 and 3 above, provided that you
release the Modified Version under precisely this License, with the
Modified Version filling the role of the Document, thus licensing
distribution and modification of the Modified Version to whoever
possesses a copy of it. In addition, you must do these things in
the Modified Version:
A. Use in the Title Page (and on the covers, if any) a title
distinct from that of the Document, and from those of previous
versions (which should, if there were any, be listed in the
History section of the Document). You may use the same title
as a previous version if the original publisher of that
version gives permission.
B. List on the Title Page, as authors, one or more persons or
entities responsible for authorship of the modifications in
the Modified Version, together with at least five of the
principal authors of the Document (all of its principal
authors, if it has fewer than five), unless they release you
from this requirement.
C. State on the Title page the name of the publisher of the
Modified Version, as the publisher.
D. Preserve all the copyright notices of the Document.
E. Add an appropriate copyright notice for your modifications
adjacent to the other copyright notices.
F. Include, immediately after the copyright notices, a license
notice giving the public permission to use the Modified
Version under the terms of this License, in the form shown in
the Addendum below.
G. Preserve in that license notice the full lists of Invariant
Sections and required Cover Texts given in the Document’s
license notice.
H. Include an unaltered copy of this License.
I. Preserve the section Entitled “History”, Preserve its Title,
and add to it an item stating at least the title, year, new
authors, and publisher of the Modified Version as given on the
Title Page. If there is no section Entitled “History” in the
Document, create one stating the title, year, authors, and
publisher of the Document as given on its Title Page, then add
an item describing the Modified Version as stated in the
previous sentence.
J. Preserve the network location, if any, given in the Document
for public access to a Transparent copy of the Document, and
likewise the network locations given in the Document for
previous versions it was based on. These may be placed in the
“History” section. You may omit a network location for a work
that was published at least four years before the Document
itself, or if the original publisher of the version it refers
to gives permission.
K. For any section Entitled “Acknowledgements” or “Dedications”,
Preserve the Title of the section, and preserve in the section
all the substance and tone of each of the contributor
acknowledgements and/or dedications given therein.
L. Preserve all the Invariant Sections of the Document, unaltered
in their text and in their titles. Section numbers or the
equivalent are not considered part of the section titles.
M. Delete any section Entitled “Endorsements”. Such a section
may not be included in the Modified Version.
N. Do not retitle any existing section to be Entitled
“Endorsements” or to conflict in title with any Invariant
Section.
O. Preserve any Warranty Disclaimers.
If the Modified Version includes new front-matter sections or
appendices that qualify as Secondary Sections and contain no
material copied from the Document, you may at your option designate
some or all of these sections as invariant. To do this, add their
titles to the list of Invariant Sections in the Modified Version’s
license notice. These titles must be distinct from any other
section titles.
You may add a section Entitled “Endorsements”, provided it contains
nothing but endorsements of your Modified Version by various
parties—for example, statements of peer review or that the text has
been approved by an organization as the authoritative definition of
a standard.
You may add a passage of up to five words as a Front-Cover Text,
and a passage of up to 25 words as a Back-Cover Text, to the end of
the list of Cover Texts in the Modified Version. Only one passage
of Front-Cover Text and one of Back-Cover Text may be added by (or
through arrangements made by) any one entity. If the Document
already includes a cover text for the same cover, previously added
by you or by arrangement made by the same entity you are acting on
behalf of, you may not add another; but you may replace the old
one, on explicit permission from the previous publisher that added
the old one.
The author(s) and publisher(s) of the Document do not by this
License give permission to use their names for publicity for or to
assert or imply endorsement of any Modified Version.
5. COMBINING DOCUMENTS
You may combine the Document with other documents released under
this License, under the terms defined in section 4 above for
modified versions, provided that you include in the combination all
of the Invariant Sections of all of the original documents,
unmodified, and list them all as Invariant Sections of your
combined work in its license notice, and that you preserve all
their Warranty Disclaimers.
The combined work need only contain one copy of this License, and
multiple identical Invariant Sections may be replaced with a single
copy. If there are multiple Invariant Sections with the same name
but different contents, make the title of each such section unique
by adding at the end of it, in parentheses, the name of the
original author or publisher of that section if known, or else a
unique number. Make the same adjustment to the section titles in
the list of Invariant Sections in the license notice of the
combined work.
In the combination, you must combine any sections Entitled
“History” in the various original documents, forming one section
Entitled “History”; likewise combine any sections Entitled
“Acknowledgements”, and any sections Entitled “Dedications”. You
must delete all sections Entitled “Endorsements.”
6. COLLECTIONS OF DOCUMENTS
You may make a collection consisting of the Document and other
documents released under this License, and replace the individual
copies of this License in the various documents with a single copy
that is included in the collection, provided that you follow the
rules of this License for verbatim copying of each of the documents
in all other respects.
You may extract a single document from such a collection, and
distribute it individually under this License, provided you insert
a copy of this License into the extracted document, and follow this
License in all other respects regarding verbatim copying of that
document.
7. AGGREGATION WITH INDEPENDENT WORKS
A compilation of the Document or its derivatives with other
separate and independent documents or works, in or on a volume of a
storage or distribution medium, is called an “aggregate” if the
copyright resulting from the compilation is not used to limit the
legal rights of the compilation’s users beyond what the individual
works permit. When the Document is included in an aggregate, this
License does not apply to the other works in the aggregate which
are not themselves derivative works of the Document.
If the Cover Text requirement of section 3 is applicable to these
copies of the Document, then if the Document is less than one half
of the entire aggregate, the Document’s Cover Texts may be placed
on covers that bracket the Document within the aggregate, or the
electronic equivalent of covers if the Document is in electronic
form. Otherwise they must appear on printed covers that bracket
the whole aggregate.
8. TRANSLATION
Translation is considered a kind of modification, so you may
distribute translations of the Document under the terms of section
4. Replacing Invariant Sections with translations requires special
permission from their copyright holders, but you may include
translations of some or all Invariant Sections in addition to the
original versions of these Invariant Sections. You may include a
translation of this License, and all the license notices in the
Document, and any Warranty Disclaimers, provided that you also
include the original English version of this License and the
original versions of those notices and disclaimers. In case of a
disagreement between the translation and the original version of
this License or a notice or disclaimer, the original version will
prevail.
If a section in the Document is Entitled “Acknowledgements”,
“Dedications”, or “History”, the requirement (section 4) to
Preserve its Title (section 1) will typically require changing the
actual title.
9. TERMINATION
You may not copy, modify, sublicense, or distribute the Document
except as expressly provided under this License. Any attempt
otherwise to copy, modify, sublicense, or distribute it is void,
and will automatically terminate your rights under this License.
However, if you cease all violation of this License, then your
license from a particular copyright holder is reinstated (a)
provisionally, unless and until the copyright holder explicitly and
finally terminates your license, and (b) permanently, if the
copyright holder fails to notify you of the violation by some
reasonable means prior to 60 days after the cessation.
Moreover, your license from a particular copyright holder is
reinstated permanently if the copyright holder notifies you of the
violation by some reasonable means, this is the first time you have
received notice of violation of this License (for any work) from
that copyright holder, and you cure the violation prior to 30 days
after your receipt of the notice.
Termination of your rights under this section does not terminate
the licenses of parties who have received copies or rights from you
under this License. If your rights have been terminated and not
permanently reinstated, receipt of a copy of some or all of the
same material does not give you any rights to use it.
10. FUTURE REVISIONS OF THIS LICENSE
The Free Software Foundation may publish new, revised versions of
the GNU Free Documentation License from time to time. Such new
versions will be similar in spirit to the present version, but may
differ in detail to address new problems or concerns. See
.
Each version of the License is given a distinguishing version
number. If the Document specifies that a particular numbered
version of this License “or any later version” applies to it, you
have the option of following the terms and conditions either of
that specified version or of any later version that has been
published (not as a draft) by the Free Software Foundation. If the
Document does not specify a version number of this License, you may
choose any version ever published (not as a draft) by the Free
Software Foundation. If the Document specifies that a proxy can
decide which future versions of this License can be used, that
proxy’s public statement of acceptance of a version permanently
authorizes you to choose that version for the Document.
11. RELICENSING
“Massive Multiauthor Collaboration Site” (or “MMC Site”) means any
World Wide Web server that publishes copyrightable works and also
provides prominent facilities for anybody to edit those works. A
public wiki that anybody can edit is an example of such a server.
A “Massive Multiauthor Collaboration” (or “MMC”) contained in the
site means any set of copyrightable works thus published on the MMC
site.
“CC-BY-SA” means the Creative Commons Attribution-Share Alike 3.0
license published by Creative Commons Corporation, a not-for-profit
corporation with a principal place of business in San Francisco,
California, as well as future copyleft versions of that license
published by that same organization.
“Incorporate” means to publish or republish a Document, in whole or
in part, as part of another Document.
An MMC is “eligible for relicensing” if it is licensed under this
License, and if all works that were first published under this
License somewhere other than this MMC, and subsequently
incorporated in whole or in part into the MMC, (1) had no cover
texts or invariant sections, and (2) were thus incorporated prior
to November 1, 2008.
The operator of an MMC Site may republish an MMC contained in the
site under CC-BY-SA on the same site at any time before August 1,
2009, provided the MMC is eligible for relicensing.
ADDENDUM: How to use this License for your documents
====================================================
To use this License in a document you have written, include a copy of
the License in the document and put the following copyright and license
notices just after the title page:
Copyright (C) YEAR YOUR NAME.
Permission is granted to copy, distribute and/or modify this document
under the terms of the GNU Free Documentation License, Version 1.3
or any later version published by the Free Software Foundation;
with no Invariant Sections, no Front-Cover Texts, and no Back-Cover
Texts. A copy of the license is included in the section entitled ``GNU
Free Documentation License''.
If you have Invariant Sections, Front-Cover Texts and Back-Cover
Texts, replace the “with...Texts.” line with this:
with the Invariant Sections being LIST THEIR TITLES, with
the Front-Cover Texts being LIST, and with the Back-Cover Texts
being LIST.
If you have Invariant Sections without Cover Texts, or some other
combination of the three, merge those two alternatives to suit the
situation.
If your document contains nontrivial examples of program code, we
recommend releasing these examples in parallel under your choice of free
software license, such as the GNU General Public License, to permit
their use in free software.
Index
*****
* Menu:
* /inet/ files (gawk): Gawk Special Files. (line 389)
* /inet/tcp special files (gawk): File /inet/tcp. (line 509)
* /inet/udp special files (gawk): File /inet/udp. (line 537)
* | (vertical bar), |& operator (I/O): TCP Connecting. (line 607)
* advanced features, network connections: Troubleshooting. (line 652)
* agent: Challenges. (line 1746)
* agent <1>: MOBAGWHO. (line 2608)
* AI: Challenges. (line 1746)
* apache: WEBGRAB. (line 2203)
* apache <1>: MOBAGWHO. (line 2644)
* Bioinformatics: PROTBASE. (line 3428)
* BLAST, Basic Local Alignment Search Tool: PROTBASE. (line 3205)
* blocking: Making Connections. (line 306)
* Boutell, Thomas: STATIST. (line 2224)
* CGI (Common Gateway Interface), dynamic web pages and: Web page.
(line 1002)
* CGI (Common Gateway Interface), library: CGI Lib. (line 1287)
* CGI (Common Gateway Interface): MOBAGWHO. (line 2644)
* clients: Making Connections. (line 292)
* Clinton, Bill: Challenges. (line 1729)
* Computational Biology: PROTBASE. (line 3428)
* contest: Challenges. (line 1677)
* cron utility: STOXPRED. (line 2906)
* CSV format: STOXPRED. (line 3011)
* Dow Jones Industrial Index: STOXPRED. (line 2927)
* ELIZA program: Simple Server. (line 1472)
* ELIZA program <1>: Simple Server. (line 1639)
* email: Email. (line 906)
* FASTA/Pearson format: PROTBASE. (line 3303)
* FDL (Free Documentation License): GNU Free Documentation License.
(line 3561)
* filenames, for network access: Gawk Special Files. (line 384)
* files, /inet/ (gawk): Gawk Special Files. (line 389)
* files, /inet/tcp (gawk): File /inet/tcp. (line 509)
* files, /inet/udp (gawk): File /inet/udp. (line 537)
* finger utility: Setting Up. (line 823)
* Free Documentation License (FDL): GNU Free Documentation License.
(line 3561)
* FTP (File Transfer Protocol): Basic Protocols. (line 242)
* gawk, networking: Using Networking. (line 332)
* gawk, networking, filenames: Gawk Special Files. (line 384)
* gawk, networking, connections: Special File Fields.
(line 445)
* gawk, networking, connections <1>: TCP Connecting. (line 584)
* gawk, networking, service, establishing: Setting Up. (line 807)
* gawk, networking, email: Email. (line 899)
* gawk, web and: Interacting Service.
(line 1088)
* gawk, networking, troubleshooting: Caveats. (line 1654)
* getline command: TCP Connecting. (line 589)
* GETURL program: GETURL. (line 1892)
* GIF image format: Web page. (line 1002)
* GIF image format <1>: STATIST. (line 2224)
* GNU Free Documentation License: GNU Free Documentation License.
(line 3561)
* GNU/Linux: Troubleshooting. (line 699)
* GNU/Linux <1>: Interacting. (line 756)
* GNU/Linux <2>: REMCONF. (line 1946)
* GNUPlot utility: Interacting Service.
(line 1268)
* GNUPlot utility <1>: STATIST. (line 2224)
* Hoare, C.A.R.: MOBAGWHO. (line 2608)
* Hoare, C.A.R. <1>: PROTBASE. (line 3205)
* hostname field: Special File Fields.
(line 424)
* HTML (Hypertext Markup Language): Web page. (line 986)
* HTTP (Hypertext Transfer Protocol): Basic Protocols. (line 242)
* HTTP (Hypertext Transfer Protocol) <1>: Web page. (line 963)
* HTTP (Hypertext Transfer Protocol), record separators and: Web page.
(line 986)
* HTTP server, core logic: Interacting Service.
(line 1088)
* HTTP server, core logic <1>: Interacting Service.
(line 1101)
* Humphrys, Mark: Simple Server. (line 1639)
* Hypertext Markup Language (HTML): Web page. (line 986)
* image format: STATIST. (line 2224)
* images, retrieving over networks: Web page. (line 1002)
* images, in web pages: Interacting Service.
(line 1268)
* JavaScript: STATIST. (line 2298)
* Linux: Troubleshooting. (line 699)
* Linux <1>: Interacting. (line 756)
* Linux <2>: REMCONF. (line 1946)
* Lisp: MOBAGWHO. (line 2698)
* localport field: Gawk Special Files. (line 389)
* Loebner, Hugh: Challenges. (line 1677)
* Loui, Ronald: Challenges. (line 1746)
* MAZE: MAZE. (line 2479)
* Microsoft Windows, networking: Troubleshooting. (line 699)
* Microsoft Windows, networking, ports: Setting Up. (line 840)
* Microsoft Windows: WEBGRAB. (line 2174)
* MiniSQL: REMCONF. (line 2049)
* MOBAGWHO program: MOBAGWHO. (line 2608)
* NCBI, National Center for Biotechnology Information: PROTBASE.
(line 3205)
* network type field: Special File Fields.
(line 400)
* networks, gawk and: Using Networking. (line 332)
* networks, gawk and, filenames: Gawk Special Files. (line 384)
* networks, ports, specifying: Special File Fields.
(line 413)
* networks, gawk and, connections: Special File Fields.
(line 445)
* networks, gawk and, connections <1>: TCP Connecting. (line 584)
* networks, gawk and, service, establishing: Setting Up. (line 807)
* networks, ports, reserved: Setting Up. (line 840)
* networks, gawk and, email: Email. (line 899)
* networks, gawk and, troubleshooting: Caveats. (line 1654)
* Numerical Recipes: STATIST. (line 2254)
* ORS variable, POP and: Email. (line 931)
* ORS variable, HTTP and: Web page. (line 986)
* PANIC program: PANIC. (line 1853)
* Perl: Using Networking. (line 340)
* Perl, gawk networking and: Using Networking. (line 350)
* Perlis, Alan: MAZE. (line 2479)
* pipes, networking and: TCP Connecting. (line 612)
* PNG image format: Web page. (line 1002)
* PNG image format <1>: STATIST. (line 2224)
* POP (Post Office Protocol): Email. (line 899)
* POP (Post Office Protocol) <1>: Email. (line 931)
* Post Office Protocol (POP): Email. (line 899)
* PostScript: STATIST. (line 2380)
* PROLOG: Challenges. (line 1746)
* PROTBASE: PROTBASE. (line 3205)
* protocol field: Special File Fields.
(line 406)
* PS image format: STATIST. (line 2224)
* Python: Using Networking. (line 340)
* Python, gawk networking and: Using Networking. (line 350)
* record separators, POP and: Email. (line 931)
* record separators, HTTP and: Web page. (line 986)
* REMCONF program: REMCONF. (line 1946)
* remoteport field: Gawk Special Files. (line 389)
* RFC 1939: Email. (line 899)
* RFC 1939 <1>: Email. (line 931)
* RFC 1945: Web page. (line 986)
* RFC 2068: Web page. (line 963)
* RFC 2068 <1>: Interacting Service.
(line 1181)
* RFC 2616: Web page. (line 963)
* RFC 821: Email. (line 899)
* robot: Challenges. (line 1755)
* robot <1>: WEBGRAB. (line 2137)
* RS variable, POP and: Email. (line 931)
* RS variable, HTTP and: Web page. (line 986)
* servers: Making Connections. (line 285)
* servers, as hosts: Special File Fields.
(line 424)
* servers <1>: Setting Up. (line 823)
* servers, HTTP: Interacting Service.
(line 1088)
* servers, web: Simple Server. (line 1467)
* Simple Mail Transfer Protocol (SMTP): Basic Protocols. (line 242)
* Simple Mail Transfer Protocol (SMTP) <1>: Email. (line 899)
* SMTP (Simple Mail Transfer Protocol): Basic Protocols. (line 242)
* SMTP (Simple Mail Transfer Protocol) <1>: Email. (line 899)
* STATIST program: STATIST. (line 2224)
* STOXPRED program: STOXPRED. (line 2889)
* synchronous communications: Making Connections. (line 306)
* Tcl/Tk: Using Networking. (line 340)
* Tcl/Tk, gawk and: Using Networking. (line 350)
* Tcl/Tk, gawk and <1>: Some Applications and Techniques.
(line 1838)
* TCP (Transmission Control Protocol): Using Networking. (line 355)
* TCP (Transmission Control Protocol) <1>: File /inet/tcp. (line 509)
* TCP (Transmission Control Protocol), connection, establishing: TCP Connecting.
(line 584)
* TCP (Transmission Control Protocol), UDP and: Interacting. (line 779)
* TCP/IP, sockets and: Gawk Special Files. (line 374)
* TCP/IP, network type, selecting: Special File Fields.
(line 400)
* TCP/IP, protocols, selecting: Special File Fields.
(line 406)
* troubleshooting, networks, connections: Troubleshooting. (line 652)
* troubleshooting, gawk, networks: Caveats. (line 1654)
* troubleshooting, networks, timeouts: Caveats. (line 1666)
* UDP (User Datagram Protocol): File /inet/udp. (line 537)
* UDP (User Datagram Protocol), TCP and: Interacting. (line 779)
* Unix, network ports and: Setting Up. (line 840)
* URLCHK program: URLCHK. (line 2059)
* vertical bar (|), |& operator (I/O): TCP Connecting. (line 607)
* VRML: MAZE. (line 2479)
* web pages: Web page. (line 963)
* web pages, images in: Interacting Service.
(line 1268)
* web pages, retrieving: GETURL. (line 1892)
* web servers: Simple Server. (line 1467)
* web service: Primitive Service. (line 1033)
* web service <1>: PANIC. (line 1853)
* WEBGRAB program: WEBGRAB. (line 2137)
* Weizenbaum, Joseph: Simple Server. (line 1472)
* XBM image format: Interacting Service.
(line 1268)
* Yahoo!: REMCONF. (line 1946)
* Yahoo! <1>: STOXPRED. (line 2889)